Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Jim lives in Detroit, MI. One day, Jim is at a local bar. He has had a few drinks, but he is not intoxicated. As he is about to leave, he asks the bartender for a cup of water. The bartender by mistake hands him a 6 ounce cup of 40% Vodka instead. Jim gulps down the glass quickly. He notices the strength of the liquid, but figures that it must be his imagination, as he clearly asked for water. Jim gets in his car and drives home.

Unfortunately for him, the vodka goes straight to his head and he becomes intoxicated. Because of Jim's intoxication, he loses control of his car, which jumps a curb and kills 2 people. Jim is arrested and put on trial under Michigan's "causing death while operating a motor vehicle while intoxicated" statute, which carries a penalty of up to 15 years in prison.

Jim wants to argue that he did not knowingly drink enough to make him drunk. However, the judge instructs the jury that whether Jim knew that the liquid that he drank was vodka was irrelevant because driving while intoxicated is a strict liability offense.

Jim's attorney claims that this would be unconstitutional because it would not be fair to give someone such a severe punishment without proving any mens rea on Jim's part.

Who is correct? Please use appropriate case law to support your answer.

An IRAC-based essay is appropriate for this assignment.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92423315
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question 1you are advised to first perform the appropriate

Question 1 You are advised to first perform the appropriate hypothesis test using pencil and paper, along with a calculator and statistical tables, and then use your working to answer the questions below. An administrato ...

Question based on the summary of research findings

Question: Based on the summary of research findings identified from the Evidence-Based Project-Paper on Diabetes that describes a new diagnostic tool or intervention for the treatment of diabetes in adults or children, c ...

You need a reflection of this topic500 word apa formatthe

You need a reflection of this topic:(500 word APA format) The positive and negative effects of colonization and how this affects and shape Arab countries ? Although colonialism is often completely negative, especially by ...

Question cultural autobiography case study and training

Question: Cultural Autobiography Case Study and Training Intervention: Students will develop a case study based on a time in their life where they experienced a microaggression(s) which he or she believe impacted their a ...

Question write a 750-1000-word paper outlining the

Question: Write a 750-1,000-word paper outlining the importance of empathy, probing, and summarizing in the counseling process. Include the following in your paper: 1. The role of empathy in the counseling relationship 2 ...

Learn about defending against ddosusing word write an

Learn About Defending Against DDoS Using WORD, write an ORIGINAL brief essay of 300 words or more: Find a DoS attack that has occurred in the last six months You might find some resources at f-secure. Note how that attac ...

Question please respond to the contentment you have read in

Question: Please respond to the contentment you have read in Craigie Chapter 10 1. Do you have any insights on Craigie's work presented on transcendence and the pursuit of valued direction? 2. What framework, with clinic ...

Task 1 extending the bankaccount class1 copy the files

Task #1 Extending the BankAccount Class 1. Copy the files AccountDriver.java and BankAccount.java from Blackboard. BankAccount.java is complete and will not need to be modified. 2. Create a new class called SavingsAccoun ...

Assignment -purpose - the purpose of this report is to

Assignment - Purpose - The purpose of this report is to demonstrate research and academic literacy skills. You need to produce writing that is clear, concise and meaningful, whilst now incorporating evidence from sources ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As