Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Informational flyer designed for a specific set of readers. You will need to gather data from various sources, and then interpret and incorporate the data into tables, charts, diagrams, or illustrations. Be creative with color, placement, and graphics.

When planning the flyer, think carefully about how readers will use the information and how you can use graphics to make the facts as accessible, understandable, and useful as possible. Refer to Chapters 12 and 14 for specific ideas.

Choose one of the following scenarios:

Present a description of a process that would be important for clients to know if they are going to purchase products or services. You may use the kind of employer you would like to work for after graduation. Example: A computer information systems student might explain the differences between Power Point and Prezi presentations.

Present an explanation of a basic concept in your major addressed to students who have just begun course work in it. Example: An accounting student might show how credits and debits function in a ledger.

Present an explanation of a concept from your major that is important for members of the general public to understand as they make decisions.

Example: A respiratory therapy student might show how smoking harms the lungs in the respiratory system.

The flyer should only be one page. Make sure you proofread the flyer for spelling, grammar, and formatting. Data from sources needs to be correctly cited

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92485485
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Assignment 3 gender identitywe are socialized at every

Assignment 3: Gender Identity We are socialized at every stage in life to conform to our gender identity. Societal reinforcement of tendencies of gender identity is relentless. For example, in hospitals, little girls are ...

Assignment team training powerpoint presentation group

Assignment : Team Training PowerPoint Presentation (Group Project) Identify a health technology or a specific aspect of a payment system that is changing for your health care setting. Work as a team to prepare a PowerPoi ...

Provide a short explanation concerning how response

Provide a short explanation concerning how response selection (in the information process model) might be influenced by attentional capacity.

How does perception differ from sensation how do these

How does perception differ from sensation? How do these processes differ? How are they the same?

Question to demonstrate information literacy by using the

Question: To demonstrate information literacy by using the search engine PsycINFO, you will locate THREE scholarly peer-reviewed journal articles ABOUT POSTPARTUM DEPRESSION. After resources are located, you will use APA ...

Assignmentconsider what you have been learning in regards

Assignment Consider what you have been learning in regards to the influences of culture on learning. Culture affects how children learn and develop language skills in the classroom. What strategies, then, can early child ...

The sociological imaginationfor this submission you will

The Sociological ImaginationFor this submission, you will write a journal entry after reflecting on a current sociological topic. Journal entries provide the writer with an opportunity to collect his or her thoughts and ...

Question select two real companies or businesses you will

Question: Select two real companies or businesses. You will have to give a new name to the companies selected. Your selection will be kept on the secret until the presentation of your final project. Watch these two video ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question please follow db instructions i need for the db to

Question: Please follow DB instructions. I need for the DB to be answered for myself 400 words and 1 reply 250 words as if I am responding to my peers. immediate need for this assignment to be completed 10/2/18 APA forma ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As