Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Indonesia is an archipelago in Southeast Asia between the Indian and Pacific oceans. Gamelan is the Indonesian term for a musical ensemble. These ensembles are made up of a mixture of instruments of all types: membranophones, idiophones, chordophones, and aerophones. Occasionally, singers are included.

     Gamelan music influenced a number of twentieth-century American composers. Henry Cowell became one of its foremost exponents. Cowell’s father exposed him to a variety of music, especially the music of China, Japan, and Tahiti. In 1914, Cowell began studying at the University of California at Berkley with the musicologist Charles Seeger. In the later 1920s Cowell was in New York teaching. While there, he won a Guggenheim Foundation grant to study in Berlin. In Berlin he studied gamelan music with Raden Mas Jodjhana of Java.

     Cowell’s music reflects many of the characteristics of the international music he absorbed. One of the percussive influences present in his music is the use of tone clusters, the simultaneous hitting of adjacent keys on the piano. Another piano technique that Cowell devised was to have the performer silently displace keys so those strings would be undamped and then have the performer reach over with the other hand and strum those strings. This is most manifest in his piece The Banshee.

     Chinese culture has also influenced contemporary American composers. Music in China has always been conceived as a system that reflects the order of the universe. The Chinese believed that the foundation tone, or huang chung, had a social, cosmological, and mystical influence. From this mystical tone, the Chinese musical system derived twelve tones or lu. In modern performance, most Chinese music is based on a pentatonic scale.

     John Cage, a student of Henry Cowell, was influenced by a great deal of non-Western music, especially the music of China. Cage traveled widely to absorb different influences and get new ideas. In addition to studying with Cowell, he studied with Arnold Schonberg. In 1940, Cage was hired to provide music for a dance production. Restricted to a solo, he wanted to develop a way of expanding the percussive effects to fit the African character of the dance. The result was a prepared piano with a variety of materials on and between the strings and hammers. Cage wrote numerous pieces for prepared piano throughout his career.

    Cage was influenced by more than Chinese culture. In the mid-1940s he became interested in Zen Buddhism. He also studied with an Indian singer. But Harvard University’s anechoic chamber had probably the most profound effect on him. After spending time there, completely isolated from sounds of the outside world, he became aware of the sounds of his own body. This led to a different approach to music and one of his most famous compositions, 4’33”.   

QUESTIONS AND TOPICS 

1. The two most distinct types of Indonesian gamelan music are Javanese and Balinese. The differences between these types are slight, however, and might be missed by the casual listener. The differences have to do with tempo, types of instruments used, and rhythmic and dynamic changes. Balinese gamelan is also characterized by the kotek, the sharing of a melody by trading notes of different pitches (interlocking). Javanese gamelan shows more Muslim influence.

2. Gamelan music influenced composers of the nineteenth century as well as contemporary composers. Claude Debussy was aware of and used elements of the gamelan in some of his music. In his Nocturnes, he used Javanese scale patterns and rhythmic patterns. Igor Stravinsky was influenced by Asian and African music. His approach to rhythm was developed from African polyrhythm.

3. Aleatoric, or chance music, can take many forms. It was not an invention of the twentieth century, either. Musical games in the eighteenth century involved creating melodies by rolling dice and piecing together composed phrases.

FURTHER TOPICS FOR DISCUSSION

1. Ask your students about their reaction to Cage’s 4’33”. How does this fit with their understanding of music?

2. Much of non-Western music focuses on rhythm and melody. These cultures haven’t developed a complex harmonic system with specific chords and chord progressions. Harmony is a result of polyphonic textures being created and the use of drones.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91079297

Have any Question?


Related Questions in Homework Help/Study Tips

Copy corporation sells copier toner over the telephone in

Copy Corporation sells copier toner over the telephone in bulk. A-Copy's sales representatives solicit mail orders from targets through random sales calls that include frequent overt misrepresentations. Dan advised that ...

Learn about defending against ddosusing word write an

Learn About Defending Against DDoS Using WORD, write an ORIGINAL brief essay of 300 words or more: Find a DoS attack that has occurred in the last six months You might find some resources at f-secure. Note how that attac ...

Watch the video titled the exclusionary rule for dummies -

Watch the video titled, "The Exclusionary Rule for Dummies - Mapp v Ohio and the 4th Amendment" (11 min 12 s). You can also view the video. Next, examine two (2) exceptions to the rule. Provide your opinion as to whether ...

Assignment -recoil affecting system performance - show the

Assignment - Recoil affecting system performance - Show the big efferent between fixed and free recoil on Muzzle velocity, it must just be discussed with a bit of detail. Refer to the table in the text. How a recoil syst ...

Assignment - an ios recipe applicationintroductionin this

Assignment - An iOS Recipe Application Introduction In this assignment, you will create a simple Recipe application for iOS using Xcode (Swift). This application allows users to view food recipes. Read the entire Assignm ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question quantitative and qualitative research reviewchoose

Question: Quantitative and Qualitative Research Review Choose two scholarly, peer-reviewed nursing articles about research studies. One article must be an example of a qualitative research study; the other must be a quan ...

Comment 1 the projected nursing shortage can incur

Comment 1: The projected nursing shortage can incur significant impact to the nursing profession and to the public. For one, the anticipated increase of the U.S aging population, this will put more strain on the nursing ...

Discussion do you feel that public health initiatives

Discussion : Do you feel that public health initiatives executed by the federal government make a difference in prevention/awareness/cessation of the issues brought forth by the agency? Why or why not? Write an original ...

Comment 1 ulcerative colitis uc and crohns disease are

Comment 1: Ulcerative colitis (UC) and Crohns disease are inflammatory bowel diseases, not to be confused with inflammatory bowel syndrome (IBS). Describe the differences in symptom manifestations, and how those manifest ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As