Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Imagine that you've been asked to give a short speech to a group of International students visiting Florida State College from Dubai, United Arab Emirates. Before you do so, surely you'd want to research Dubai in order to relate to your audience. Feel free to research as much as you'd like in order to discuss the following questions. There is a fact sheet at the end of this assignment that you may wish to use as well. Then answer the following discussion questions providing details, examples and your own insight and analysis.

Remember demographics typically cover gender/gender roles, political affiliations, religious affiliations, age, ethnic background, income level, educational level, etc.

1. What stereotypes might you already have when you consider this audience? It's okay to be honest here. Once you acknowledge what you believe or have heard/read/been taught, you can better focus on the reality. How would allowing these stereotypes to influence your speech hinder your presentation?

2. List 3 demographics that you feel would differ for these students vs. students originating from the United States. Which of these 3 demographics would you consider most important to keep in mind as you speak to these students? Why?

3. What might you include in this presentation that you would normally not consider relevant or necessary to address for U. S. students? Why? What should you consider as you choose your examples and details? What about the use of slang, idioms, and jargon?

Country

Dubai United Arab Emirates

Emirate

Dubai

Founded by

Rashid bin saeed Al Maktoum

Seat

Dubai

Subdivision

Towns and villages

Government


  • Type

Constitutional monarchy

  • Ruler

Mohammed bin Rashid Al Maktoum

  • Crown Prince

Hamdan bin Mohammed bin Rashid Al Maktoum

Languages Spoken

Arabic, English

Population


  • Total

2,106, 177

  • Indian

53%

  • Emirati

17%

  • Pakistani

13.3%

  • Bangladeshi

7.5%

  • Filipino

2.5%

  • Sri Lankan

1.5%

  • American

0.3%

  • Other Countries

5.7%

Time Zone

UAE standard time (UTC+4)

Website

Dubai Emirate, Dubai Municipality

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91421841
  • Price:- $50

Priced at Now at $50, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Using a current bill illustrate how a bill becomes a law in

Using a current bill, illustrate how a bill becomes a law in the federal government. Discuss how which steps the bill has already passed, and then explain which steps it has left to become a law. Please use the link belo ...

Question topic 1 child and adolescent health risksas you

Question: Topic 1: Child and Adolescent Health Risks As you discovered in this week's lectures and readings, several populations face multiple health risks across their lifespan. Children and adolescents are a population ...

A researcher wants to see how people respond to three new

A researcher wants to see how people respond to three new ad campaign for potato chips. One is funny (A sleeping guy thinks he is eating the best tasting potato chips in the world, though when he wakes up he is chewing o ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question review your states mandated reporter statute

Question: Review your state's mandated reporter statute. Provide details about this in your post. If faced with a mandated reporter issue, what are the steps in reporting the issue? Create a mandated reporter scenario an ...

Question 1identify the main external forces triggering the

Question: 1. Identify the main external forces triggering the requirement for organizational change. Pick any three and discuss how they might necessitate behavioral change on the part of organizational employees. 2. Exp ...

Assignmentwrite a 1750- to 2100-word paper in which you

Assignment Write a 1,750- to 2,100-word paper in which you analyze the values of the organization for which you work, or one with which you are familiar. Observe and analyze the corporate or business culture. Include the ...

What are the similiarities as well as differences between

What are the similiarities as well as differences between the figure sculptures Kritos Boy, The Riace Warriors, and Polykleito's Doryphoros?

Discussion the media and public trust please respond to

Discussion : "The Media and Public Trust" Please respond to the following: • Discuss one or two reasons it seems that the media have lost the public trust in the U.S. • Debate It - Take a position on this statement: Demo ...

Question changes in human resource management hrm and

Question: Changes in Human Resource Management (HRM) and Employment Law"Please respond to the following: • Based on the assigned chapters this week, identify three (3) key changes that have advanced HR and provide a just ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As