Im pretending to be the president of a public relations, Ask an Expert

Others

I'm pretending to be the president of a public relations firm for a company called "Smallmart" and there is a lawsuit against us claiming that we don't promote female employees past a certain level. How can I, internally, motivate the female staff without involving the public anymore then they already are?

View complete question

Homework Help/Study Tips, Others

Category:- Homework Help/Study Tips
Reference No.:- M9901189

Have any Question?Write your Review or question?

Related Questions in Homework Help/Study Tips

Assignment tasks corporate regulationido you own research

ASSIGNMENT TASKS CORPORATE REGULATION (i) Do you own research and critically discuss whether the financial accounting and reporting should be regulated or manager should be allowed to disclose financial accounting inform ...

Question correlation and regression studybackground during

Question: Correlation and Regression Study Background: During this week you will identify a research question created in Week 1 for which correlation or regression would be the best statistical approach to take. If you d ...

-study and understand the three environmental systems

-study and understand the three environmental systems theories: Vygotsky's Sociocultural theory, Bronfenbrenners Bioecological theory and the family systems theory. -choose one of the following five issues: same-sex marr ...

Question write an 1500 words essay about the chosen plant

Question: Write an 1500 words essay about the chosen plant (Basil) following the prompt below: Scientific and Medical Evidence( Chosen plant; Basil) Herbs and plants contain chemical compounds; some of them are effective ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question as the human resources manager it is your

Question: As the human resources manager, it is your responsibility to keep all human resources employees informed about current employment law. You want to empower employees with resources that they can use independentl ...

Discussion 1this week you will reflect on the debate of

Discussion 1: This week you will reflect on the debate of organized sports vs. unstructured free play. Over the years, parents, teachers, and researchers have weighed the advantages and disadvantages of each in considera ...

Assignment 4 annual reviewimagine you work at a company and

Assignment 4: Annual Review Imagine you work at a company and it is time for an employee named Jim's annual review. While he was a model employee the first nine (9) months of the year, recently Jim has been coming in lat ...

Context over time high crime rates have become commonplace

Context: Over time, high crime rates have become commonplace and many new and creative solutions have surfaced and faded; however, some have lasted longer than others. By empowering agencies to test new theories, innovat ...

Question write a 3-page not counting title and reference

Question: Write a 3-page (not counting title and reference pages) APA-style essay that includes the following: • An explanation of Acceptance and Commitment Therapy (ACT) that presents the major beliefs and assumptions a ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Homework Help/Study Tips Expert