Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

I need three sentences focusing on corporate social responsibility regarding this unconvential oil play in North Dakota. I am only allowed three sentences which makes it difficult. I need the three sentences to focus on corporate social responsibility, not oil or advantages of the Bakken formation

The development of the Bakken formation in the Williston Basin in North Dakota is one of the largest unconventional oil plays in the world. As a petroleum engineer working for a production company who has an interest in developing their property in this area, what would you tell the VP of Development is the companies greatest corporate social responsibility (CSR) when planning the development? BE SPECIFIC.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91053061

Have any Question?


Related Questions in Homework Help/Study Tips

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Public sector financial management case study - mpa

Public Sector Financial Management Case Study - MPA Capstone Answer the following Question for the case : Write Ms. Dewing's memorandum. What recommendations should be made to the budget director? The response must be ty ...

Question 1read frontline the gospel of matthew jesus as a

Question: 1. Read Frontline: The Gospel of Matthew: Jesus as a teacher even greater than Moses 2. Read "Gospel of Matthew" in The Complete Gospels (pages 61 - 120) 3. Watch "I Came Not to Bring Peace, But a Sword." Matth ...

Please answer each question separately each question must

Please answer each question separately. Each question must be 250-300 words each. Please be plagiarism free. 1. Discuss how understanding Biblical principles of planning influences decision making in healthcare. 2. As a ...

Question i need to select one of the following prompts

Question: I need to select one of the following prompts below to serve as the basis for a persuasive essay. There needs to be a firm stance on the prompt and there needs to be a written 5-paragraph, double-spaced essay s ...

Instructionsrespond to the following twenty 20 questions

Instructions Respond to the following twenty (20) questions. You must answer every question. A guide to the length of your response is provided following each question. 1. Explain the term 'group dynamics'. 2. Explain th ...

Question review the topic materials and the work completed

Question: Review the Topic Materials and the work completed in NRS-433V to formulate a PICOT statement for your capstone project. My topic is stroke A PICOT starts with a designated patient population in a particular cli ...

Question by now you have identified and done some

Question: By now, you have identified and done some literature search on your Module 1 Session Long Project (SLP) topic/health behavior and target population. In short, you have assessed the need for a program or interve ...

Question part 1 think about how to build teams in terms of

Question: Part 1: Think about how to build teams in terms of designing the task, selecting the people, and then, managing their relationships. How would compose a team for completing a course/work project in terms of the ...

Question write a brief summary of the argument of each of

Question: Write a brief summary of the argument of each of the following critical excerpts, including at least one reference to something specific that the author says about The Awakening to support the argument. Each of ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As