Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Humanity:Discussion 1: Mozart

1. The first movement of Mozart's Symphony No. 40 in G Minor is based on variations on a three-note motif. Explain why you think this Classical music form may be satisfying for both 18th century and contemporary listeners - and whether it was enjoyable for you.

2. Mozart was considered a child prodigy, performing throughout Europe. Cite your view on the notion of the child star and the impact of early success on a person who shows exceptional talent or genius. Explain whether you think Mozart's struggle with sustained success in adulthood was a product of this phenomenon.
Discussion 2: Representations of Slavery

3. By creating awareness of oppression and arousing sympathy of supporters, the arts can be a form of protest. Identify and describe an example of how either black slaves or white abolitionists used the arts as a form of protest against slavery.

4. Explain whether you think an autobiographical or fictional account by a slave (such as Phillis Wheatley and Olaudah Equiano) is more persuasive than a biographical or fictional account by a white author (such as John Gabriel Stedman or Aphra Behn).

5. Explain whether you think the representations of slavery in the visual arts (such as William Blake's illustrations, William Hackwood's cameo, or John Singleton Copley's painting) were more compelling and convincing of the injustices of slavery than literary representations.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91613457

Have any Question?


Related Questions in Homework Help/Study Tips

Assignmentintroductionprovide an overall description of the

Assignment Introduction:?Provide an overall description of the school and classroom, be specific.? Describe the demographics of the class?(numbers by race, gender, ESE, ESOL). Planning and Preparation:?How does the class ...

Question details medication alone is not as successful in

Question: Details: Medication alone is not as successful in treating anxiety disorders as psychotherapy in combination with medication. Conduct current and scholarly research about why this is the case. Write a 1,200-1,5 ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question 1 what is patent protection briefly discuss the

Question: 1. What is patent protection ? Briefly discuss the patent protection and legal protection? 2. What are the four mechanisms of appropriability? The response must be typed, single spaced, must be in times new rom ...

Assignment requirement -assignment reflective writing aims

Assignment Requirement - Assignment Reflective writing aims to get you to think about your learning and understand your learning experiences. When students writing Assignment 3 need to follow steps: 1. Evaluate the effec ...

Discussion advocating for social change techniques and

Discussion: Advocating for Social Change: Techniques and Tools A critical part of your development as a counseling professional involves working for positive social change. In fact, your ultimate goal of becoming a clini ...

Design project of network distributionreporting for the

Design Project of Network Distribution Reporting for the Design Project Part 1 - Executive Summary This should be a short (2-3 page, including diagrams) summary of your proposed network, including justification for the d ...

Group presentation research security vulnerability tools

Group Presentation: Research Security vulnerability tools using Kali (Linux) Topic - SQLMAP As a group, present for approximately 30 minutes on one of the following topics. Groups need to self-organise in earlier weeks, ...

Question 1 considering the concept of black swans described

Question: 1) Considering the concept of "Black Swans" described in the 2014 QHSR, how does this concept relate to changes in the strategic environment or prevailing strategic challenges? Do you agree with the four Black ...

Question - write article about the topic with apa

Question - Write article about the topic with APA references. Discuss the process used to preserve the verifiable integrity of digital evidence. Textbook - Cyber Crime and Cyber Terrorism, Fourth Edition by Robert W. Tay ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As