Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

How Good Are Your Communication Skills

Summary of my communication quiz score

In an effective communication, the recipient of the information should understand it the same way the originator wants it understood. There are several skills of effective communication. I will discuss these skills below as I show my strengths and weaknesses in my professional life.

Strengths

Clarity and concession: I plan upfront by predicting what might bring confusion to the people. I also find it difficult in using pictures and diagrams in conveying my message because I conceive it to be more confusing to most people.
Respect: Mails are scanned for typos to make them more understandable. I also think of what the people needs to hear and totally explain concepts to avoid confusion or misconception. Above all, I respect everyone's culture.

Empathy: I am quite good in this because I usually see other people's perspectives while addressing me.
NonverbalCommunication: I pay attention to people's body language

Feedback: When people are talking to me I think of what I will respond to them.

Right medium: I usually consider the right medium to use in communication. Email is not one of them.

Weaknesses

Open mindedness: I keep things to myself and usually do not care of how others will perceive it. This is a problem with my control of emotions and stress which I am now going through counseling process.

Confidence: Due to lack of confidence, I find that sometimes people do not understand my message. This is caused by sending confusing signals due to my inconsistent body language. I have started a training to curb this.

Other aspects of effective communication such as listening and friendship skills have not been discussed here. A good listener is always a good communicator. Also friendly tone and smile always attract honest communication.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91369783
  • Price:- $35

Guranteed 24 Hours Delivery, In Price:- $35

Have any Question?


Related Questions in Homework Help/Study Tips

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question given the various predisposing factors that make

Question: Given the various predisposing factors that make humans susceptible to opportunistic infections, how can healthcare providers curtail the rising incidence of such infections? (8 sentences) The response must be ...

What is a summary exactlywhat kinds of information does it

What is a summary exactly? What kinds of information does it include? What tone should you use in writing an effective summary?

You need a reflection of this topic500 word apa formatthe

You need a reflection of this topic:(500 word APA format) The positive and negative effects of colonization and how this affects and shape Arab countries ? Although colonialism is often completely negative, especially by ...

Question read about horace mann john dewey the northwest

Question: Read about Horace Mann, John Dewey, the "Northwest Ordinance of 1787," the "Morrill Land Grant College Act of 1862," "Brown vs. Board of Education" decision, and "President Lyndon B. Johnson's Commencement Addr ...

Question need assistance with writing the

Question: Need assistance with writing the following. Instructions: In class we discussed a range of different emotions that can be incorporated into an emotional appeal and tips for doing so effectively. For this activi ...

Task backgroundrefer to background information provided in

Task Background Refer to background information provided in Assessments 1 and 2 regarding the Headspace NewAccess project. The project is considering cloud-based solutions which should be investigated. Consider various a ...

Question research and critique an experimental studyprior

Question: Research and Critique an Experimental Study Prior to beginning work on this assignment, be sure to have read all the required resources for the week. Find an experimental research study on the topic chosen in W ...

Discuss the george zimmermantrayvon martin case from a

Discuss the George Zimmerman/Trayvon Martin case from a legal perspective. Please answer the following: What crimes was George Zimmerman been charged with in the death of Trayvon Martin? What defense(s) did he raise? Wha ...

Reply to the two students discussion below 125 words each

Reply to the two students discussion below 125 words each reply. First student, Having two teenagers both in high school, I know all too well the issues with social media, the internet and not being able to disconnect wi ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As