Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Health, Safety and Environmental Management - This assessment contains 3 task based on a given scenario.

Scenario

TZ&Y Company specializes in carrying out market research on behalf of demanding international clients. The company was founded in 2005 by the current managing director Mr. Ian Doug and is still based in its original premises which comprise four open plan rooms, two unisex toilets and a welfare area where employees can make refreshments. The office is designed to accommodate 40 employees.

The workforce is mainly young college and university graduates aged 21-25 on short, fixed-term contracts. Shifts can often last up to 11 hours and include regular nights. Employees are paid a basic wage plus an incentive bonus for additional hours. Hot- desking is common and there are often insufficient workstations available, meaning laptops are frequently used.

A new employee has recently complained to a supervisor about the long hours, abuse from colleagues and acoustic shock caused by callers shouting on the phone. In addition, he has pointed out that employees have no control over lighting levels or temperature in the office. The supervisor has refused to report the concerns to the managing director.

Profitability in the company is good and the managing director has recruited a consultant who has recently updated the company's health and safety policies and procedures.

These are now comprehensive and cover risk assessments, first aid, fire safety and display screen equipment. However, employees have not been consulted or informed of the policies.

The managing director has promised to move to new state-of-the-art offices when the current lease expires in nine months' time. He has refused to make any changes until then.

Meanwhile, several fire escapes are routinely blocked; Housekeeping, including trailing cables, is extremely poor; No induction training is provided; there is no provision for eyesight tests; several employees are reporting repetitive strain symptoms; Up to 60 employees may be working at any one time.

Based on the case study you are to write a report of 2500 words, your report should cover the following task:

a) A critical evaluation of the safety and health conditions of the workplace and system of work.

b) Prepare a general health and safety policy for the company highlighting managements' commitment to managing the health and safety risk associated with the company's activities.

c) How would you promote employee involvement or participation in the implementation of the the health and safety policy prepared in (b).

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92766267
  • Price:- $70

Priced at Now at $70, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question instructionsread and critically analyze this weeks

Question: Instructions Read and critically analyze this week's assigned readings related to considerations within the IoT field. Select a technical challenge, issue, consideration, or other topic from this week's reading ...

Discussion 1 describe what you learned about the impact of

Discussion 1: Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environment. Use at least one reference and interact with at least two classmates. Discussion 2: ...

Assignment - practical assessmentscenariouser modelling

Assignment - Practical Assessment Scenario User Modelling Inc. would like to organize a series of conferences focusing on research topics in the area of user adaptive systems and personalization. They need to organize an ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Instructions for assignment 1 task 1 reporting the results

Instructions for Assignment 1, Task 1: Reporting the Results of a Website Evaluation In addition to performing in this role, students must also recruit two other individuals (adults that may or may not be in this class) ...

One of the core symptoms of post-traumatic stress disorder

One of the core symptoms of post-traumatic stress disorder (PTSD) is intrusive memory: disturbing, unwanted memories of the traumatic event keep coming back, either in waking life or in dreams. Recently, it has been sugg ...

Diana examines violence prevention programs she is

Diana examines violence prevention programs. She is interested in the differences in number of referrals for violent behavior between two schools. One school has implemented a violence prevention program and the other ha ...

Module casefirst read the information on this site then

Module Case First, read the information on this site. Then, discuss in 2-3 pages (not including the cover sheet and bibliography) the following items: Shuttleworth, M. (n.d.). Different research methods. Case Assignment ...

Question 1 after reading about the soliloquy in the module

Question: 1. After reading about the soliloquy in the module notes and discussing whether Hamlet's actions can be considered as heroic, you are ready to analyze the "to be or not to be" soliloquy. For this assignment, yo ...

Question 1 list and explain the four common challenges

Question: 1. List and explain the four common challenges leadership faces. 2. The Employment-at- Will is a doctrine developed as part of British common law which applies to many states in the U.S. List the major exceptio ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As