Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Global Warming: A Major Concern

According to World Health Organization (WHO), global warming is the primary issues for concern. Noise pollution, overcrowding, traffic jams are some factors that have led to this problem.

Lack of privacy is another factor in the modern times that is impacting people in ways that haven't been examined yet. We also see a wide variance in weather patterns, such as severe hurricanes and drought conditions in the U.S.

Source: World Health Organization (WHO). (n.d.). Climate change.

Based on your understanding of the topic, create a report in a Microsoft Word document answering the following questions:

Examine one weather condition over the past two years in the U.S. which drastically affected the population. How can the community better prepare their families for such severe conditions?

Do you agree with the statement that countries should be held accountable for their contribution to climate change? Why or why not?

List some of the issues that might occur as the world's population increases? Factor in water, food, and hazardous waste into your comments. Suggest ideas to address or avoid these issues.

According to the CDC website, violence is attributed for approximately fifty thousand deaths each year and results in over 2.5 million injuries.

Homicide and suicide are the second and third leading causes of death, respectively, among US population aged fifteen to thirty four years.

Hospital emergency departments treat an average of fifty five people for injuries every minute. The worst after effect of the sudden population explosion across the globe is the rise in violence.

How have violent injuries affected a community? What steps have communities taken to decrease overall violent crimes?

What steps can the federal or state governments take to help support communities affected from random or consistent violent acts?

What can parents do in their homes to help educate children about risks and preventative accidents to help keep them safe? What role should parents take to reduce family violence?

How can health promotion and wellness programs play a significant role to reduce individual or gang violence?

How can schools and work environments increase safety measures against violent individuals or gangs entering their establishments?

What roles should parents, neighbors, friends, health care personnel, and the community take when they observe someone who may exhibit unusual behavior or comments to help prevent potential violence? What agencies or resources are available to help communities cope and help their members seek help or assistance?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92850662
  • Price:- $15

Priced at Now at $15, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Please respond to the following questionin responding to

Please respond to the following question. In responding to this week's questions students need to keep in mind that these are "mini essays" more than "discussions", under 600 words. The philosophers Thomas Hobbes and Joh ...

What is the relationship between race socio-economic status

What is the relationship between race, socio-economic status and cruel and unusual punishment? Consider the history of the United States and the 8th Amendment in your response

Discussion 1 what are the basic reasons that people resist

Discussion: 1) What are the basic reasons that people resist change? How can this resistance be overcome? The response must be typed, single spaced, must be in times new roman font (size 12) and must follow the APA forma ...

Compare between the liberal and conservative approaches to

Compare between the liberal and conservative approaches to the US foreign and domestic policy. Identify the whys and where fores of the differences between these two approaches. Attachment:- SPECTRUM OF POLITICAL IDEOLOG ...

Question select a topic for your critical reviewselect the

Question: Select a Topic for Your Critical Review Select the topic for your Critical Review, which is due in Week Six, and briefly analyze its key features and pathophysiology. You may select from any of the following ps ...

Individual reportanswering the following three questions1

Individual Report Answering the following three questions: 1) Is a non-ethnic racial identity possible for Latinos / Hispanic Americans? How or why not? (Think back to the race and ethnicity conceptualization previously ...

Question recall a situation in which you and your

Question: Recall a situation in which you and your co-workers or fellow students were highly motivated and effective. What motivation theories help you account for this high level of performance? THEORIES OF MOTIVATION S ...

Foodco franchise australiaresearch rational discuss issues

Foodco franchise Australia Research rational (discuss issues of Australia about foodco franchise) Reason of Failure Scope of future

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question please answer all questions with a minimum of 100

Question: Please answer all questions with a minimum of 100 words. 1. How are introverts and extroverts formed? Does personality explain this? 2. What did you find most interesting in Chapter 9 (P.O.W.E.R Learning: Diver ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As