Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Given the following business scenario, create a Crow’s Foot ERD using a specialization hierarchy if appropriate. Tiny Hospital keeps information on patients and hospital rooms. The system assigns each patient a patient ID number. In addition, the patient’s name and date of birth are recorded. Some patients are resident patients who spend at least one night in the hospital, and others are outpatients who are treated and released. Resident patients are assigned a room. Each room is identified by a room number. The system also stores the room type (private or semiprivate) and room fee. Over time, each room will have many patients. Each resident patient will stay in only one room. Every room must have had a patient, and every resident patient must have a room.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M9881090

Have any Question?


Related Questions in Homework Help/Study Tips

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Each essay question is to be between 500-700 words -

Each essay question is to be between 500-700 words - excluding direct quotes. You are to provide at least 3 references other than your readings to support each response. These references are to be in APA format. Correspo ...

Question review science of persuasion by

Question: Review Science of Persuasion (By influenceatwork) • Describe an example of any of the six forms of persuasion that were used on you as a consumer. What was the outcome? • In the example you provided, discuss th ...

How does marijuana drug works within the central nervous

How does Marijuana drug works within the central nervous system. who is the synaptic target of this and how it alter chemical neurotransmission in the synapse. Which neurotransmitter is the major target. Does the drug wo ...

Discussion recognizing and avoiding plagiarismwhat is

Discussion: Recognizing and Avoiding Plagiarism What is plagiarism exactly? Is it always done on purpose? The rules related to plagiarism can be complex, and there are instances in which people who have unwittingly plagi ...

Question social work1 identify one form of trauma that you

Question: SOCIAL WORK 1. Identify one form of trauma that you feel would make it difficult for you to tolerate or ‘bear witness to' in your role as a social worker. Forms are trauma include but are not limited to: assaul ...

Assignment reflective practitioner journal response

Assignment : Reflective Practitioner Journal Response -Assessing Oral Language and Vocabulary In this assignment, you will write the third reflective journal response of this course. You will write six such journal respo ...

Answer the following question 1 watch the english language

Answer the following Question : 1. Watch "The English Language Arts Standards: Key Changes and their Evidence" and "The Mathematics Standards: Key Changes and Their Evidence" videos on the Common Core standards. Based on ...

Question go to the internet and find a news article

Question: Go to the internet and find a news article published within the last three months that discusses balancing the federal budget of the U.S. and fiscal policy, summarize key points and post in the Discussions area ...

Question you work for a medium-sized it firm and your boss

Question: You work for a medium-sized IT firm and your boss mentions that recently a number of employees have received calls from individuals who didn't identify themselves and asked a lot of questions about the company ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As