Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Genogram

The health history is a very important part of a health care puzzle. Understanding the family history provides information about diseases that are familial. As you know, genograms are important in determining how diseases affect families, and are pictorial representations of family relationships and medical histories. As mentioned earlier, they are often used to depict common diseases within a family.

A genogram allows the user to visualize hereditary patterns and can be useful in identifying repetitive patterns of behavior and to recognize hereditary tendencies.

For this assignment, select a patient from your clinical experience whom you are completing a subjective, objective, assessment, and plan (SOAP) note on and complete a genogram based on his or her family history.

If you have not started clinical practice, then select a non-family member and complete a family history on him or her to complete a genogram. Write up the family history and create and save a family genogram in the same document.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92249248

Have any Question?


Related Questions in Homework Help/Study Tips

Question based on how you will evaluate your ebp project

Question: Based on how you will evaluate your EBP project, which independent and dependent variables do you need to collect? Why? The response must be typed, single spaced, must be in times new roman font (size 12) and m ...

Assignment 2 positive psychology and spiritualitysubstance

Assignment 2: Positive Psychology and Spirituality Substance abuse counseling lends itself nicely to the integration of positive psychology and spirituality. While both of these therapy approaches have been explored for ...

Assignment -what do we learn from the standard deviation

Assignment - What do we learn from the standard deviation statistic? What is the difference between the SD and 95% CI? As Normal distribution is a base assumption for most statistical tests, what should we do when distri ...

Criminology question -a there is wide spread of argument

CRIMINOLOGY Question - a) There is wide spread of argument about the legalization of marijuana in the United States, those in favor of it insist that it has medicinal value of benefits to patients, while those opposing i ...

Topic applying classical and

TOPIC: Applying Classical and Contemporary Sociological Theories OBJECTIVES: The objectives of the assignment are for students to demonstrate: Understanding of sociological theory, Application of sociological theory, Abi ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question this was actually a great topic to discuss about

Question: This was actually a great topic to discuss about because they deal with a form of communication. Its amazing how blackboard and coarse management can handle thousands of kids at once. This most likely increased ...

Question topic substance abuse opioids epidemic

Question: Topic( Substance Abuse, Opioids Epidemic) PowerPoint Identification of the social problem with research supporting the background presented. 1. You must demonstrate that this social problem exists by communicat ...

Question one function of lipid is to provide energy glucose

Question: One function of lipid is to provide energy. Glucose is our body's preferred energy source, but fatty acids provide an alternative energy source when needed. Protein is the third essential macro-nutrient. This f ...

Question there is belief that the united states is a

Question: There is belief that the United states is a "Christian Nation." Based on the founding documents and and the prevalent Enlightenment ideals of the 18th century, how could this assignment be supported or opposed? ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As