(Answered) For this reflection i want you to listen to the following

Others

For this reflection, I want you to listen to the following podcast from NPR: http://www.npr.org/sections/money/2016/12/02/504155809/episode-739-finding-the-fake-news-king (Enlaces a un sitio externo.) (or, you can read it here: http://www.npr.org/templates/transcript/transcript.php?storyId=504155809) (Enlaces a un sitio externo.). Then, think about the following questions / respond to a couple of them in paragraph form (not essay form--by paragraph form, I mean answer each one in a different paragraph with enough detail to explain what you mean).

Questions:

1. What did you know about fake news going into this podcast? How has that knowledge changed?

2. What surprised you from the podcast?

3. What does this podcast illustrate about your own searching / reading choices?

4. Have you ever read something online and posted it, only to find out later that it was fake? What was your response / thought? 5. How might this story have inspired people to take negative actions?

6. Why should we be careful when reading / posting / spreading fake news?

View complete question

Homework Help/Study Tips, Others

Category:- Homework Help/Study Tips
Reference No.:- M92217259
Price:- $20

Verified Expert

Priced at $40 Now at $20, Verified Solution

Have any Question?Write your Review or question?

Related Questions in Homework Help/Study Tips

The course project is based on the following scenarioa new

The Course Project is based on the following scenario: A new president has been selected to run your university. His first initiative is to impose a new strategic direction that focuses on three key priorities: · Increas ...

Question social change and policy advocacy in human

Question: Social Change and Policy Advocacy in Human Services Policy advocacy is one of the key roles of human services professionals. It differs from advocating for clients in that it looks to inform those who are respo ...

Question 1 what strategies will you use in your new role in

Question: 1. What strategies will you use in your new role in health care to review and critique. Strategies can come in many shapes and forms.Know there is a process to review and critique various types of literature. L ...

Satre argues that we make ourselves through our

Satre argues that we make ourselves through our choices. Describe his argument for his point of view. Is Satre correct about free will being the main factor that determines who you are-or do such things as genetics and s ...

Question eco 204 principles of microeconomicsanalyze the

Question: ECO 204: Principles of Microeconomics Analyze the major barriers for entry and exit into the airline industry. Explain how each barrier can foster either monopoly or oligopoly. What barriers, if any, do you fee ...

As the authors of your course text emphasize motivating

As the authors of your course text emphasize, motivating employees should be a goal of all center directors because motivated employees are more likely to maintain a standard of excellence in the workplace. How can direc ...

Ar the following question can vaccines cause autism

Answer the following Question : Can Vaccines Cause Autism? ShouldGenetically Modified Foods Be Regulates? Should the U.S. Continue its Human Spaceflight Program. Do We Need New Laws to Protect the Public from Cybercrime? ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Proposal of assignment develop system with visual studio

Proposal of Assignment DEVELOP SYSTEM WITH VISUAL STUDIO AND LINK TO DATABASE ( MS ACCESS ) 1. Samsung Offline Mobile Purchasing System (TITLE) 2. A "Samsung" mobile selling store which recommended for customer to purcha ...

Effective business communication assignment -assessment -

EFFECTIVE BUSINESS COMMUNICATION ASSIGNMENT - Assessment - Reflective Practice Essay: Developing your Communication Competency Task Description: The objective of this reflective essay is to summarize what you learned fro ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Homework Help/Study Tips Expert