Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

For this Assignment, you will take the perspective of a director of a regional Environmental Protection Agency (EPA) office.

The national EPA Office of Environmental Information (OEI) has tasked all regional directors to identify an environmental hazard in your community.

(Blairsville, Ga)

For this contaminant, write a short summary of the hazard (2-3 pages) to submit to EPA OEI. In this report, please discuss the human health effects of exposure, the sources of the hazard into the environment, and the route of human exposure.

Specify whether the hazard is chemical, physical, or biological and whether this affects occupational health, the general public, or both.

Provide at least one suggestion on how to reduce the environmental hazard in your community.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M93117780
  • Price:- $20

Priced at Now at $20, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Enterprise mobile app business casewritten report approx

ENTERPRISE MOBILE APP BUSINESS CASE WRITTEN REPORT (approx. 5000 words) In this assignment, you assume the role of the enterprise's CIO. As the CIO you are impressed with the concept of the app presented to you in Assign ...

Question self-care is very important to those that work in

Question: Self-care is very important to those that work in helping professionals. It can be easy to be over-worked by doing "too much work" while working with others. What does it mean to do "too much work" as a counsel ...

Question 1 what issues does watson raise with respect to

Question: 1. What issues does Watson raise with respect to introspection? 2. What should be the role of consciousness in scientific psychology? 3. Along what lines should psychological science develop henceforth? PLEASE ...

What is the cellular defect in polycystic kidney disease

What is the cellular defect in polycystic kidney disease? And what techniques were used in discovering the cellular defect in polycystic kidney disease?

Question watch the chess experiment future brain and early

Question: Watch the "Chess Experiment," "Future Brain," and "Early Stages of Experimentation" videos available on the student website. Prepare a 3 slide Microsoft® PowerPoint® presentation with speaker notes for public s ...

Question the company that i am working on is gucciusing the

Question: The company that I am working on is Gucci Using the company you have been working with for your previous Individual Projects, write a paper of 5-7 pages outlining the following: What is the company's stated str ...

What is tension headache what are the symptoms and

What is tension headache? What are the symptoms and treatment of tension headache?

Activities 1 write smart corporate objectives to action

Activities 1. Write SMART corporate objectives to action your mission statement. 2. Approach a local business and offer to produce a mission and vision statement for the organization. Turn these statements into practical ...

Question conducting a community assessment is more

Question: Conducting a community assessment is more complicated and challenging in practice than it appears on paper or in theory. A community assessment provides a baseline measure of a variety of conditions and resourc ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As