Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

For this assignment you will be stepping into the role of "expert". You are one, of many, training specialists in your company and have been asked to submit a proposal for a training module for managers on how to meet the learning needs of their departmental employees.

The title of your proposed training will be "The Importance of Understanding Your Employees'/Learners' Needs" and it will include two parts: the written portion and the "pitch", which will be submitted as a screencast presentation that includes audio and visuals.

Part One: The Written Assignment

For the written portion of your final assignment, you will research and critically explain five topics (areas of content) in learning that you think would be important to teach others. These components will be aligned with the course content and the following Learning Theories:
Behaviorism - repetition, reinforcement (feedback), association, and classical and operant conditioning
Cognitivism - assimilation, accommodation, the information processing model, and intellectual stimulation
Constructivism - scaffolding, metacognition, problem-solving and inquiry-based learning
Humanism - holism, personal agency, individualization, and motivation

The five learning perspectives/principles you decide to focus on is up to you. In week four you submitted seven ideas to your instructor. Be sure to read this feedback to accurately choose the five you will use in the final.

The second requirement of the written assignment includes explaining five strategies that you would use if you were to teach/train the assigned managers. For example, you may want to use scaffolding or the use of rewards. Fully explain why you will use each of the strategies you choose and how they support the assigned employee group. In week four you submitted seven ideas. Be sure to look at your instructor feedback and choose the strategies that you feel would be the most important.

Required content elements of the written assignment:

Must begin with an introduction paragraph that includes an overall summary of the purpose of the assignment.

Five areas of learning psychology content must be explained fully and clearly demonstrate your understanding of the included content and its importance in understanding learners' needs. As you explain your learning perspectives/principles, critically and elaborately justify why you have chosen them based on your learner group.

Five strategies, for which you would use to successfully train the learner group, must be fully developed, including the rationales for how these strategies might be used, based on critical thought. Discussion of the specific needs these managers may have to fully benefit from your training module should also be included.

A conclusion paragraph or section that fully summarizes the information within the paper and also includes the time frame that you predict it will take to complete the training (i.e. two weeks, one year, etc.) Substantiate this time frame with creative and critical thoughts about how your learners will best retain the information you want to teach them.

Apply basic research methods and gather resources that will support your content.

Required technical elements of your written assignment:

Must be five to six double-spaced pages in length, excluding title page and references, and formatted according to APA style as outlined in the Ashford Writing Center.

Must include a title page with the following:

Title of presentation
Student's name
Course name and number
Instructor's name
Date submitted

URL link to your screencast

Must use at least four scholarly sources from the Ashford University Library.

Must document all sources in APA style as outlined in the Ashford Writing Center.

Must include a separate reference page that is formatted according to APA style as outlined in the Ashford Writing Center.

Must be submitted to the Grammarly tool within the course prior to submission.

A Suggested Outline

Through the use of headings and subheadings, you should be able to thoroughly explain what you would like to teach and how you will approach your training. Please see the "PSY331 Suggested Outline format" document for an example.

Part Two: The Final Presentation

After completing your paper, it will be time to "sell your idea" to the company. You will create a presentation with the goal of having your training module chosen for use by the company to train its management teams. For this presentation, you will produce a screencast presentation, much like what you created in Week Three. You will only be allotted five minutes for your presentation, so you will need to showcase your ideas effectively. Learning how to market yourself and sell your ideas will be extremely advantageous to you in your current and/or future career, so you should think outside of the box and be as creative as possible in the presentation portion of this final assignment. Additionally, this final assignment will help you build technical skills that will potentially aid you in your current and/or future career.

Consider the following questions as you create your presentation:

How will your training module "win out" over the other candidates for this project?

What makes your training module great?

In what ways are you able to meet all of your learners' special needs?

Is your training engaging? Why?

How does your training consider the diversity of the learners?

How does your training consider items such as the time it takes to go through each module and/or how it will impact employee work productivity?

In real life, this pitch could mean a big promotion or bonus. How will you get this promotion?

Presentation required elements:

Visuals, audio, and a web link for access.

Discussion of a minimum of five areas of learning content you have studied in this course, which you included in your paper and applied to the development of activities you created for your training.

Discussion of the needs of your learners that were considered.

An outline of the strategies you have suggested in your paper and why you think these will be successful when working with the assigned manager group.

A brief analysis of why it is important to apply learning theory to training/educating in organizational settings.

The reason why you believe that your training would be the best option for the company to choose.

A reference slide (This slide does not require audio.)

Five minutes in length maximum.

Discuss your ideas and content as you would if you were standing in front of a group. Try to not simply read your slides.

Create a professional in appearance presentation.

Exhibit confidence in your voice when discussing the proposed training.

Utilization of four scholarly sources. (These may be the same as in your paper.)

All sources used within the presentation must be cited properly.

FAQs:

Do I have to use a script?

Please note that although a script is not required, it can be useful to make sure your audio is clear and confident.

What if I do not have a microphone?

If you do not have an internal or external microphone for your computer, you can also use your ear buds, plugged into the microphone slot.

What if I like to use Prezi instead of PowerPoint?

You may use a number of tools to create the visual portion of your presentation (i.e. PowerPoint, Jing, Google Drive, Prezi, etc.).

How many slides should I have?

There is no specific requirement, just please consider that approximately six to eight slides would support your time limit.

What do I use to include the audio on my presentation?

To create your presentation with the required visual, audio, and website link, you may use any number of options which might include Screencast-O-Matic, or Youtube, but you are not limited to these options. You may choose to use any tool that you choose, as long as the presentation can be fully viewed and listened to by way of a web link. Please include a title for your presentation in the description box when you publish your screencast to the web.

I cannot figure out any of the online software tools. What do I do?

Second option for your presentation : If you are unable to access any screencast software, you may also choose to create a PowerPoint self-running presentation; however please note that you must also consider the timing of your audio to automatically play with each slide. The following links can assist you if you choose this option.

To learn more about including audio in a PowerPoint presentation.

To learn more about creating a self-running presentation.

What do you mean by pitch my idea?

The slides should provide selling points that support the training module included in your paper. You should have put a lot of time and effort into your paper; the presentation is where you convince your boss how great it is and why the company should go with your proposal. Be confident in your product and what you have learned and let it shine through in your presentation.

How to Give an Awesome (PowerPoint) Presentation (Whiteboard Animation Explainer Video)

How to Pitch Your Ideas, Craft or Art

You will submit both your written paper and presentation files for the final assignment for grading. Please include your presentation link in the comment section of your Waypoint upload as well as on your title page.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91780903
  • Price:- $50

Priced at Now at $50, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question 400 word discussion board post with in-text

Question: 400 Word Discussion Board Post with in-text citations and references Topic: Corporations/organizations have been described as having their own cultures. Discuss how an organization's culture can be compared to ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question discuss the type i and type ii errors and how

Question : Discuss the Type I and Type II errors and how those can cause the researcher to reach a wrong conclusion. Discuss the role of power in statistics and what tests you can perform to find the power. Be sure to su ...

Explain the difference between adaptive testing and

Explain the difference between adaptive testing and traditional testing. Give an example of each.

Assignment -in the lectures of 21 august and 18 september

Assignment - In the lectures of 21 August and 18 September and the tutorials following these lectures (21 August, 18 and 25 September) three segmentation solutions were derived using a dataset from Bank X: 1. A segmentat ...

Question apa format 3 peer references and discussion needs

Question: APA format 3 peer references and discussion needs to be related to what is posted as response to the persons diagnosis Patient Initials: RF Age: 15 Gender: M SUBJECTIVE DATA: Chief Complaint (CC): A dull pain i ...

Question new content for week 5 system implementation and

Question: New Content for Week 5: System Implementation and Maintenance Individual Project Submission - Submit to the Unit 5 IP Area The Verbania project is nearing completion. The solution is nearly ready for implementa ...

Public healthwrite an analysis of the federal governments

Public Health Write an analysis of the federal government's role in public health and discuss the cost of implementing a program of your choosing. Make an argument either for or against spending tax payers' dollars on th ...

Question 2-3 page assignment1 imagine you are working in a

Question: 2-3 page assignment 1. Imagine you are working in a community agency and would like to offer a group. A survey of clients reveals that there is a community need to address one of the following topics: • Divorce ...

Criminal profilingdiscussion questionsexplain the

Criminal Profiling Discussion Questions Explain the difference between signature behavior and offender signature. Explain the difference between active signature behaviors and passive signature behaviors. Provide one exa ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As