Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

For Milestone Two, you will submit a draft of the Judicial Administration section of your scenario analysis. Using your assigned reading, course materials, and the scenario provided below (the same scenario that you worked on in Milestone One and will use for the final project) you will analyze the impact of judicial administration components-calendaring and docketing, and the roles of court staff and litigation participants.

Scenario

Jed, Herman, and Jane live in Washington, D.C. Jed and Jane entered the local bank and took $65,000. Jed and Herman both used shotguns during the robbery, though no one was hurt. Jane drove the getaway vehicle. Two hours later, as they headed toward the Canadian border, they were stopped by the police for speeding and taken into custody. The police determined that Jed and Jane matched the eyewitness descriptions of the robbers. Jane confessed their bank robbery scheme. Jed and Herman denied their involvement. The police only recovered $25,000 in cash, but were unable to determine if the recovered money was taken from the bank. The police determined that Jed was a convicted felon at the time of the armed bank robbery. The local police and FBI were involved in the investigation.

The defense attorneys for each defendant (Jed, Herman, Jane) request a continuance for four months to sift through the evidence. The prosecution objects and argues that the delay would significantly clog the court's already heavy workload. In the alternative, the prosecution argues that if the court grants a continuance, then the prosecution should be allowed to prolong turning over the remaining discovery. The defense attorneys object and argue that this hinders their effective representation of their clients and would hinder a prompt resolution. The defense attorneys further argue that their clients deserve a well prepared and thorough defense. The judge currently has trials blocked over the next 10 months and wants to try the case now.

Specifically, the following critical elements must be addressed:

II. Judicial Administration

A. Analyze how federal, state, and local courts calendar and docket cases. Are these processes effective in promoting efficiency? Defend your
response.

B. Describe how the calendaring and continuance of this scenario would be handled differently in the state system versus the federal system.
Defend your response.

C. Identify the key role within federal and state judicial systems that most impacts process. How does this role aid in creating and maintaining an efficient and effective judicial process?

F. Determine the impact of venue on process efficiency in this scenario. Defend your response.

G. Explain how a four month continuance affects the efficiency of any court under the circumstances presented in the scenario. Defend your
response.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92383822
  • Price:- $15

Priced at Now at $15, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question 1 what are the four major-government sponsored

Question: 1) What are the four major-government sponsored insurance programs and who do they serve? 2) Name and describe three methods used by most healthplans to create their fee schedule that they use to pay physicians ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Film papernbsp the last conquistador 2007general directions

Film Paper:  The Last Conquistador" (2007) General Directions: Create an essay with A, B, and C content below (use MLA). Print your essay and bring to class by the due date. (**Also UPLOAD your paper file to the Course D ...

Question descartes tries to solve the mind-body problem by

Question: Descartes tries to solve the mind-body problem by positing that mind (or soul) and body (or matter) both exist, each representing a fundamentally different form of reality, and that each can affect the other. T ...

Lab - bioremediation by oil-eating bacteriastudy questions1

Lab - Bioremediation By Oil-Eating Bacteria Study Questions 1. Define oleophilic microbes and bioremediation. 2. Describe the process for cleaning up an oil spill using oil eating bacteria. 3. What three things do OEMs n ...

Question you are taking a trip around the world choose 3 to

Question: You are taking a trip around the world! Choose 3 to 5 countries from around the world. (At least one from each other major continent [Asia, South America, North America, Europe, Australia, Africa].) Then write ...

Question public health leadership500 words not including

Question: Public Health Leadership 500 words not including min 3 ref APA In the early 20th century, rural areas of China experienced deplorable health conditions. Due to extreme poverty and lack of access to adequate med ...

Pavlov thought that all learning entailed classical

Pavlov thought that all learning entailed classical conditioning, whereas Thorndike thought the same thing about instrumental conditioning. Given what you know about predictability, controllability, and the role of reinf ...

Post your analysis of three aspects of motivation ie the

Post your analysis of three aspects of motivation (i.e., the will to lead, express dominance, and commit to the social good of the organization) that are essential in developing leadership skills and your personal experi ...

Assignment -prepare 11 slides presentation on given

Assignment - Prepare 11 Slides presentation on given project. Project - Development of fingerprint in voting system Goals: The main goal of the project is to develop fingerprint voting system in order to given the facili ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As