Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Following three chapters of theological preparation in Ephesians, Paul, as he often does, begins to devote the remainder of the book to practical, ethical application. The theme of his desire for the church is for them to understand and ensure a unity of communal Christianity. Paul's call to them is based on his understanding of the unity of the Trinity and Christ's unity with the church.

Navigate to the threaded discussion below and respond to the following:

Please describe using five unique paragraphs, the practical applications of unity: in the church, in marital roles, in parenting, in work relationships.

In one additional paragraph, describe the unity motif with life in the Spirit (chapter 4) and the wearing of Christian armor (chapter 6). How is the commanded methodology of "speaking the truth in love" (4:15) indispensible in maintaining the unity in each role and relationship of a minister's life and work? In the life of every believer?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92550465
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question choose a debatable issue about which you have some

Question: Choose a debatable issue about which you have some knowledge--either through personal experience, televised newscasts, the Internet, or reading. In a multi-paragraph essay, take a stand on the issue by making a ...

Question read through the post attached in a file and

Question: Read through the post attached in a file and provide any on of the following: APA format 250 Words. • Ask a probing question, substantiated with additional background information, evidence or research. • Share ...

Assignment psychological aspects of later adulthood models

Assignment : Psychological Aspects of Later Adulthood Models of Grieving Submit a 2- to 4-page paper in which you: Explain how you, as a social worker, might apply the grieving model you selected to your work with famili ...

Primary task response within the discussion board area

Primary Task Response: Within the Discussion Board area, write 400 words that respond to the following questions with your thoughts, ideas, and comments. This will be the foundation for future discussions by your classma ...

Question previously you selected a community to be the

Question: Previously you selected a community to be the focus of your Community Project. This week you will write a one to two page summary that will examine this community, potential issues, and strategies for engaging ...

Instructionswritten assignment reflective summaryplease

Instructions Written Assignment: Reflective Summary Please write a reflective summary. In your reflective summary, include the following details as well: What have you learned about the implementation process of your new ...

Question pick a topic relevant to the information we have

Question: Pick a topic relevant to the information we have covered to date, including this week. It can cover information in Chapters 1,2,3, and 9, or any of the articles presented in the readings area. The format of you ...

Question using the south university online library or the

Question: Using the South University Online Library or the Internet, research the two major study designs-cohort and case-control-used in health care research. Find a research article on any topic in health care. Based o ...

Question refer back to the week 2 company hoosier media inc

Question: Refer back to the Week 2 company, Hoosier Media, Inc. Your consulting firm is now ready to present suggestions regarding the strategic plan of Hoosier Media, Inc. In a 10- to 20-slide presentation with speaker ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As