Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Final Paper Outline

In Week Five you will complete a Final Paper that will focus on evaluating research studies and reports to analyze a specific topic within a Health and Human Services research area. Review the instructions for your Final Paper in Week Five of the course or in the "Components of Course Evaluation" section of this guide.

This week you will submit a description of your topic area and an outline for your Final Paper. To begin, select a topic area from the Health and Human Services field.

Your topic should correspond to actual research studies that have been performed. You may find it easier to locate peer-reviewed sources as you select your topic area, to ensure that there is research available in the area you choose. Examples of possible topic areas include:

Program effectiveness of community-based mental health treatment facilities.

Perceptions of ethical competence among human service professionals working in long- term care.

Treatment intervention outcomes for veterans with post-traumatic stress disorder.

Characteristics of successful job placement programs for special needs adults.

Trends in health care legislation and impacts on health and human service delivery.

In the first part of your assignment this week, describe your selected topic area, including the problem or background issues that you would like to address in your Final Paper.

To do this, you will need to visit the Ashford University Library and locate at least eight peer-reviewed sources that pertain to your selected topic area. Your sources must present actual research studies that correspond to the problem or background of your selected topic area.

Summarize the components, attributes, and/or various segments of the topic area you have selected.

For example:

What is the research problem or issue?

Who or what is affected by this problem or issue?

What are some specific examples of research studies, evaluations, reports, literature reviews, etc. that address it?

What are the findings of these sources, and what are their implications on the health and human services field?

Then, create a detailed outline of your Final Paper. Your outline should include at least headings and sub-headings, with at least a one- to two-sentence description for each. Indicate within each section which of your sources will apply to that section.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92855667
  • Price:- $40

Priced at Now at $40, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question select a website of your choosing that sells

Question: Select a website of your choosing that sells products or services. Note: You will use this website for both the Week 3 and 4 individual assignments. Research the company to gather additional information (e.g., ...

Question in this assignment you will be completing a health

Question: In this assignment, you will be completing a health assessment on an older adult. To complete this assignment, do the following: 1. Perform a health history on an older adult. Students who do not work in an acu ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Evaluation of a business simulation the evaluation of a

Evaluation of a Business Simulation The evaluation of a business simulation is designed to relate the operation of a business department (s) in a simulation formation to the real world. It is also designed to relate clas ...

Discussion client issuesclinical mental health counselors

Discussion: Client Issues Clinical mental health counselors, like doctors and lawyers, practice in specialty areas. These areas are specific to client issues or populations for which the counselor has had advanced clinic ...

The sun has a temperature of 5780 k and emits radiation

The Sun has a temperature of 5780 K and emits radiation with a λmax of 0.5014 µm. An incandescent light bulb also emits radiation with a λmax of 0.5014 µm. What is the temperature of its filament?

Discussion forumwhat motives do corporate executives have

Discussion Forum What motives do corporate executives have that force them to embrace continuous growth of the organization, specifically related to revenue via census or cost containment? What would the results be if th ...

Assignment swot analysisno plagiarismusing the health care

Assignment : SWOT Analysis NO PLAGIARISM Using the health care companies Aetna and Addus Home Care, create a slide presentation with no more than 12 slides (with bullets) and note pages that include the following?(Note: ...

Final portfolio assignment - in this assignment you will1

Final Portfolio Assignment - In this assignment you will: 1. Describe the components of an effective leadership and management style (be sure to explain what type of organization and the differences (if any) between lead ...

Question topic critical appraisal of the evidence project

Question: Topic: Critical Appraisal of the Evidence (Project #3) Evidence-Based Practice Proposal - Section C: Literature Support Details: To begin, work through the reference list that was created in the "Section B: Pro ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As