Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Employee Morale Proposal

Imagine: you want your company to enact a policy change that will function to increase employee morale. Morale has been low lately because of several negative incidents. You may use one of the following examples or seek approval from your faculty member for a different policy change:

 (Please choose 2 that you think you can write about)

  • Allowing employees to bring pets to work
  • Increasing the amount of vacation/personal time allotted to employees
  • Allowing employees to telecommute
  • Providing free massages at work
  • Serving free drinks/food

Complete both parts of this assignment.

Part 1 - Research support for your proposal with at least one relevant and credible source that boosts your message. Use the University Library to research. Note: This means that the Internet should not be used for this exercise. 

Complete and Submit the University of Phoenix Material: Source Evaluation Matrix for two sources that you will use.

Part 2 - Write a 700- to 1,050-word proposal to the leadership in your organization, suggesting your selected change. Be sure to apply effective writing methods you learned in Ch. 12 of Excellence in Business Communication.

Format your assignment according to appropriate course-level APA guidelines.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92331761
  • Price:- $30

Priced at Now at $30, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question create a healthcare research proposal that

Question : Create a healthcare research proposal that addresses a gap in current healthcare research that would provide a benefit to the population of the Kingdom of Saudi Arabia. Be sure to support your statements with ...

Question this podcast preventing malnutrition addressing

Question: This podcast, Preventing Malnutrition: Addressing Undernutrition in Young U.S. Children by Dr. Robert Murray, will provide a good foundation for understanding child nutrition and growth challenges. Please liste ...

Question pick a topic relevant to the information we have

Question: Pick a topic relevant to the information we have covered to date, including this week. It can cover information in Chapters 1,2,3, and 9, or any of the articles presented in the readings area. The format of you ...

Question some people argue that ethics codes are just for

Question: Some people argue that ethics codes are "just for show" and really do little to deter unethical behavior by employees. Do you agree? Why or why not? Be sure to format your response in APA and provide two APA fo ...

Case study read the following case studybest hospital is a

Case Study: Read the following case study: Best Hospital is a 325-bed suburban community hospital that has just merged with a local major academic medical center, the University of Excellence Medical Center (UEMC). There ...

Theme 1please answer all questions in one threadhipaa

Theme 1 PLEASE ANSWER ALL QUESTIONS IN ONE THREAD HIPAA training: Go to "hhs gov" All students are required to take the following Medscape training programs which are free (but require registration). These videos and tra ...

Big data and analytics assignment - analytic report and

Big Data and Analytics Assignment - ANALYTIC REPORT and PRESENTATION Analytic Report Purpose: The purpose of this task is to provide students with practical experience in working in teams to write a Data Analytical repor ...

Question write a paper reflecting on how cryptography

Question: Write a paper reflecting on how cryptography impacts your current job. In the paper discuss how you see gaining in experience in cryptography will help you in the future? Requirements: • 1 - 2 pages in length ( ...

The weight of the nation part 1 part2 part3 part4 vediosin

The Weight of the Nation( part 1, part2, part3, part4) vedios. In the documentary series, many factors impacting obesity in the US were addressed. What part of the series did you find the most fascinating? In your opinio ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As