Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

EL NIÑO & THE SOUTHERN OSCILLATION: MONITORING A GLOBAL PHENOMENON WITH LOCAL DATA

Purpose

This activity will address the effects of El Nino and the Southern Oscillation (ENSO) across spatial scales, with particular attention directed to the influence of this phenomenon in the southern Appalachian Mountains.

Learning Outcomes

• Distinguish the differences between El Niño and La Niña indicators • Gain familiarity with the website: http://www.noaa.gov?• Accurately interpret data presented in figures, tables, and graphs?• Recognize relationships between ENSO and weather in our region • Consider the biological impacts of the abiotic ENSO phenomenon

Background on ENSO

El Niño (EN) is characterized by unusually warm ocean temperatures in the Equatorial Pacific, as opposed to La Niña, which characterized by unusually cold ocean temperatures in the Equatorial Pacific. El Niño is an oscillation of the ocean-atmosphere system in the tropical Pacific having important consequences for weather around the globe. These phenomena are often analyzed in conjunction with the Southern Oscillation (SO), a comparison of atmospheric pressures in the southwestern Pacific Ocean to those in the southeastern Pacific Ocean.
ENSO news reports often focus on the phenomenon's impact on South American weather, wildlife, and commerce. While it is important to remember that El Niño brings Peru rain, mudslides, and poor fishing (while La Niña produces the opposite), scientific research suggests broader meteorological impacts. What impacts the atmosphere, ultimately affects the biosphere.

Part I: A National Perspective

The figures below show "winter" snowfall values for the contiguous United States for the years 1948-2006.

The top map shows mean snowfall amounts based on the 38 "neutral years" (i.e., neither El Niño nor La Niña years). The map on the lower left shows the average departure from that mean during the ten El Niño years, while the map on the lower right shows average departures for the eleven La Niña years. All values are in inches.

1975_Winter_Snowfall.jpg

Maps available at: www.noaa.gov

1. Snowfall amounts in the Pacific Northwest and Northern Rockies were greater than the "neutral year mean" during El Niño / La Niña years between 1948 and 2006. (Circle One)

2. What topographic feature along the border of North Carolina and Tennessee is responsible for the relatively high snowfall amounts this area receives compared to other locations within the Southeast?

3. Virginia and western North Carolina received less snowfall during El Niño / La Niña years between 1948 and 2006. (Circle One)

4. How could land managers and wildland firefighters use this information to prepare for the location and intensity of summer fires?

Part II: Access Local Data

Go to the website: http://www.noaa.gov. Spend a moment looking at the home page of this site.

5. The acronym NOAA (pronounced, "Noah") is short for the National _________ _________ Administration.

6. NOAA is a division of the United States Department of ___________.

The NOAA website allows access to information about dozens of research topics including weather, climate, ecology, and hydrology.

You will investigate local ENSO effects by accessing data from an affiliate of NOAA called the National Operational Hydrologic Remote Sensing Center.?Go to their snow analysis website: http://www.nohrsc.noaa.gov/nsa/

7. Today's date is ______________. Looking at the "Automated Model Discussion," you notice that ________% of the sample area is covered by snow.

8. Scroll through selection fields titled "Select Region and Date." Data for the "National" region is available back to what year?

Data from this site will allow you to compare snow conditions for the Southern Appalachian Mountains during the El Niño winter of 2009-2010 and the La Niña winter two years (2007-2008) earlier. Under the selection field titled "Region," select: "Southern Appalachia".

9. What percent of the Southern Appalachia region was covered by snow on February 1, 2010? ___________ What was the average snow depth?

10. What percent of the Southern Appalachia region was covered by snow on February 1, 2008? __________ What was the average snow depth?

11. A. Why is it difficult to contrast El Nino vs. La Niña snow conditions in Southern Appalachia based solely on these two observations?

B. How would you use this website to formulate a testable hypothesis?

12. Choose two organisms that are native to Southern Appalachia. Write a paragraph about each organism that addresses how local snowfall variability, which is partially influenced by ENSO, could affect their habitats and the health and reproduction of the organisms.

Example organisms are the spruce-fir moss spider, northern flying squirrel, Frasier fir, eastern hemlock, black bear, rabbit, deer, wild turkey, or wild brook or speckled trout. Look up their scientific names online.

Organism A _____________ Scientific Name ____________

Organism B _____________ Scientific Name ___________

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91945821
  • Price:- $35

Priced at Now at $35, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question this assignment is simply a more expanded

Question: This assignment is simply a more expanded exploration of your chosen topic for your Persuasive Researched Essay. You will answer the same questions, but with the added insight of your classmates' responses to y ...

Assignment 11 conflicting viewpoints essay - part

Assignment 1.1: Conflicting Viewpoints Essay - Part I Prewriting The paper should follow guidelines for clear and organized writing: 1. Include an introductory paragraph and concluding paragraph. 2. Address main ideas in ...

Question as mentioned in week 1 your final project consists

Question: As mentioned in Week 1, your Final Project consists of a brief literature review on a specific topic within language or cognitive development. In this week, you will provide a brief summary of the topic you sel ...

Part 1as eecs corporate business financial analyst you will

Part 1 As EEC's corporate business financial analyst, you will need to have a clear understanding of the different types of costs (variable, fixed, and mixed) that the company carries. Complete the following for this ass ...

Question personality disorders case study

Question: Personality Disorders Case Study Presentation Choose and read any one case study from Chapter 13 (Personality Disorders) in DSM-5 in Action. Research the specific personality disorder from your chosen case stud ...

Question application 3 becoming a leader in the translation

Question: Application 3: Becoming a Leader in the Translation of Evidence to Practice Reflect on your growth, professionally and personally, since you embarked on your DNP journey. The AACN believes that one of the benef ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question 1discuss what you have learned in this course

Question: 1. Discuss what you have learned in this course about access controls and how you will apply it to your current job or future job. 2. Please provide three examples on how you will apply what you learned in this ...

Topic an hr manager has to identify hr-related issues and

TOPIC : An HR manager has to identify HR-related issues and to provide appropriate solutions by implementing suitable HRM practices as part of his role. Being a future HR manager in the contemporary business environment, ...

Question develop a solution to a specific ethical dilemma

Question: Develop a solution to a specific ethical dilemma faced by a health care professional by applying ethical principles. Describe the issues and a possible solution in a 3-5 page paper. Apply academic peer-reviewed ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As