Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

During our forum, we are discussing dreams. The meaning, origin, and analysis of dreams have fascinated psychologists since the inception of the field of psychology. Sigmund Freud, often referred to as the father of psychology, focused a great deal of his theoretical energy on trying to understand and interpret dreams.

Contemporary psychologists are beginning to recognize the interconnectivity of human physiology and psychology in a way not previously understood. This is in part because of new interest in holistic health and in part because of brain/body connections we are now able to see and understand for the first time due to enhanced technology. Yoga, mindfulness, healthy eating, meditation, holistic health - all of these practices are gaining more traction in mainstream society and among psychological circles as we recognize how the mind and body work together. In light of this growing area of interest in psychology, for this assignment you will maintain a sleep/dream journal during weeks 3 and 4, and complete an analysis and reflection on your experience in a summary reflection paper in week 5.

Specifically, for this assignment you will:

Keep a sleep/dream journal for at least 10 days throughout Weeks 3 and 4. In your journal make note of:

any dreams you had

any initial thoughts about the dream - events of the day that may relate, etc.

your general sleep schedule (if you have a tracker such as fitbit, include data on your sleep patterns as well - wakefulness, restlessness, times asleep/awake per night, total sleep, etc.)

your general eating habits by day

your general exercise habits by day

anything else of note in your psychological or physical health (stress, excitement, changes, etc.)

You may use any format you wish to record the data (notepad, computer, hardcopy spreadsheet, etc.).

Complete a 3-4 page reflection (not counting title or reference pages) in which you analyze the results of your sleep/dream journal.

Consider how your psychological and physical health interacted. What patterns did you see? Discuss the impact that various factors such as fatigue, diet, stress and exercise had on your dreams and sleep patterns. Explain how this insight may impact your behaviors in the future to lead to better psychological and physical health.

Utilize at least 2 academic resources (your text can be one of these) to support your analysis and discussion.

Title page in APA format

Reflection minimum 3 pages, double spaced

Reference page in APA format

If desired (this is optional), a copy of the original data/journal

Assignment Grading Rubric -

Provided a thoughtful analysis of how physical and psychological health interact, particularly in connecting waking behaviors with sleep and dreams.

Provided detailed evidence in the form of examples and data to support analysis and conclusions.

Described how the information gleaned from the analysis will or will not impact future behaviors and awareness.

Incorporated references from at least two academic sources.

Writing was clear, focused, organized and grammatically correct with few to no errors in spelling, punctuation, or sentence structure.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92169312
  • Price:- $25

Priced at Now at $25, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question in this assignment you will identify the

Question: In this assignment, you will identify the similarities and differences between the two sets of ethical guidelines that pertain to forensic psychology professionals-Ethical Principles of Psychologists(APA Ethics ...

Question bullselect one actual crime from each of the

Question: • Select one actual crime from each of the following crime categories: crime against persons, crime against property, and one from white-collar, corporate, or organized crime. • Briefly describe each crime. • E ...

Question money and politics please respond to the

Question: Money and Politics" Please respond to the following: Discuss two or three ways money has influenced the political process in the U.S. Support your views with one or two reasons and/or examples. (Cite any source ...

Case study assignment -it is a case study - introduction to

Case Study Assignment - It is a case study - Introduction to global management and differences in economic development and differences in culture. 3 pages including references. Use three text citations to correspond to t ...

Solid matter or heavenly visionhow does an artist create a

Solid matter or heavenly vision? How does an artist create a visual experience that takes the viewer from mundane cares to an otherworldly spiritualism? Byzantine and Islamic aesthetics aim for just this kind of transcen ...

Question the field of nursing has changed over time in a

Question: The field of nursing has changed over time. In a 1000 word paper, discuss nursing practice today by addressing the following: 1. Explain how nursing practice has changed over time and how this evolution has cha ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question multicultural competenciesprior to beginning work

Question: Multicultural Competencies Prior to beginning work on this assignment, review the article Preparing culturally competent health educators: The development and evaluation of a cultural immersion service-learning ...

Cure and control vs preventionin chapter 12 the author

Cure and Control vs. Prevention In Chapter 12, the author states "much more money is spent on the cure and control of disease than on the prevention of disease in the first place." Write a letter to the editorial board o ...

A major component of the course is the myob assignment that

A major component of the course is the MYOB assignment that is an individual assignment. Your individual assignment will be assessed on three aspects of the assignment: - MYOB Assignment: - MYOB Work Activity Report: 800 ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As