Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

DISCUSSION:

After viewing the Chinese Imports & Food Safety (Links to an external site.)Links to an external site. video, consider whether U.S. retailers that utilize products or raw ingredients that are imported from China and are poorly regulated should be liable in tort for injuries to consumers who are harmed by those products. Answer parts a and b of the prompt.

1. For this part of the prompt, answer one of the following points:

o If U.S. companies should not be liable, then they could be legally exempt from tort liability. Discuss the consequences of such a policy to U.S. consumers.

o If the U.S. companies should be liable, then those companies would not be legally exempt from tort liability. Discuss the consequences of such a policy to U.S. businesses.

2. Regardless of your response to part a, assume that U.S. retailers do have legal liability for defective products. What steps could U.S. retailers and manufacturers take when using products imported from China that would minimize their liability exposure? For example, they could warn consumers about the potential, though speculative, dangers when using products comprised of poorly regulated ingredients or components. Given your strategy, what challenges would exist for U.S. businesses that implemented your strategy?

Guided Response: Respond to at least two of your fellow students' posts in a substantive manner. Some ways to do this include the following, though you may choose a different approach, providing your response is substantive:

Discuss the challenges that would exist if your employer (or a fictitious employer) were to adopt your classmate's strategy.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92555884
  • Price:- $15

Priced at Now at $15, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question in mid-1999 the unemployment rate was 105 in

Question: In mid-1999, the unemployment rate was 10.5% in Germany, 11.3% in France, and 12.1% in Italy. What steps should those governments take to bring the unemployment rate down to the 4.3% rate in the US and the UK w ...

Provide at least three specific examples of money disorders

Provide at least three specific examples of money disorders that may be found and solutions to dealing with each disorder.

Question 1can a byod policy be intrusive and

Question: 1. Can a BYOD policy be intrusive and unethical? 2. Research the ethical debates of MDM software on personal devices. 3. Compare presentations of lessons learned on BYOD implementations. 4. Develop a BYOD polic ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question essay what traits were immediately noticed about

Question: Essay: What traits were immediately noticed about Harry Reynolds in the story "Anne Barretta" on pages 161-162 in Reframing Organizations? How should HR deal with employees like Harry? Could Anne have analyzed ...

1 please use your assignment sheet to guide your discussion

1. Please use your assignment sheet to guide your discussion. Keep your story summary brief and use the paradigm to organize your comments. Be certain to explore and discuss the technical aspects of your film. Refer to y ...

Question topic financial statement analysischoose another

Question: Topic: Financial Statement Analysis Choose another publicly traded company that begins with the same letter as your last name, but different from the one chosen in the first discussion board. Review the financi ...

Question 1in what ways can a hash value be secured so as to

Question: 1. In what ways can a hash value be secured so as to provide message authentication? 2. Elaborate on the applications, weaknesses and limitations of the hashing algorithms. The response must be typed, single sp ...

Question demonstrates critical reflection and insight with

Question: Demonstrates critical reflection and insight with all key issues, debates and concerns considered in relation to your positioning as a teacher, who you are teaching, and what you are teaching in the landscape o ...

Analytic reportpurpose the purpose of this task is to

Analytic Report: Purpose: The purpose of this task is to provide students with practical experience in working in teams to write a Data Analytical report to provide useful insights, pattern and trends in the chosen/given ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As