Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Discussion Question 1

In London on July 7, 2005, a series of coordinated attacks with an IED WMD were unleashed against London's public transport system. Is it morally or ethical right in practice to create such attacks against innocent civilians in retaliation without just cause?

Question 2

An international terrorist organization has established operations in the country of Mexico and has purchased a well-known pressure tank manufacturing firm located in Tamaulipas, Mexico. The purpose of the purchase is to enable the organization to unleash a massive WMD encased within a sealed container, which are typically shipped with sealed covers to protect the interior against exposure to the elements. The trucks will simultaneously deliver these WMD to major petro-chemical plants throughout the United States. Since this company typically delivers containers to the United States with no previous issues, security measures at the border are minimal. When all deliveries are in place, the massive containers containing the megatons of explosives will be detonated, effectively destroying the chemical plants and unleashing deadly chemicals into the prevailing winds as well as killing all life within the local vicinity.

What impact would these simultaneous attacks have on the national economy and the local communities throughout the United States? Moving past the deaths and illnesses created from the destruction, what probable impact would such destruction have on the environment? Why would this blast prove to be worse than the Oklahoma Federal Building attack in 1995?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92482767
  • Price:- $20

Priced at Now at $20, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Assignment race and sex in the workplacethe purpose of

Assignment : Race and Sex in the Workplace The purpose of this assignment is to explore race, gender, and occupational stratification in the workforce. To complete this assignment, perform the following tasks: • Choose a ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Tasksyou are required to analyse the performance of the

Tasks You are required to analyse the performance of the steam cycle, and comment on the feasibility of converting to alternative fuel sources. Making suitable approximations where required, and referencing sources of ad ...

Question i need to select one of the following prompts

Question: I need to select one of the following prompts below to serve as the basis for a persuasive essay. There needs to be a firm stance on the prompt and there needs to be a written 5-paragraph, double-spaced essay s ...

Question please respond to the followingbased on your

Question: Please respond to the following: Based on your reading this week, determine two (2) of the challenges facing multicultural teams, and suggest how to overcome each of those challenges using the delineation of pr ...

Question write in this assignment you are going to identify

Question: Write: In this assignment, you are going to identify different digital citizenship concerns and steps that can be taken to display good digital citizenship. Having this type of awareness can help you uphold goo ...

Discussion prison overcrowding has led to an increasing

Discussion : Prison overcrowding has led to an increasing number of alternative programs designed to punish offenders without the use of lengthy incarcerations. Some of these alternative programs include a form of incarc ...

Auditing amp assurance services assignment

Auditing & Assurance Services Assignment - Instructions Read the materials: 1. The research paper "The association between audit partner rotation and audit fees: empirical evidence from the Australian market" (available ...

As the newly appointed assistant to the in-service

As the newly appointed assistant to the In-service Coordinator, your responsibilities include ensuring all newly hired nurses and physicians are familiar with the legal and ethical guidelines of the facility. Discuss the ...

Psychology essay assignment - adolescent substance use

Psychology Essay Assignment - Adolescent Substance Use Disorders Treatment Approaches Paper Description - Write a 500- to 750-word opinion paper on what treatment approach seems best suited for adolescent substance use d ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As