Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Discussion 1: Western Developmental Psychology in Non-Western Cultures

For the most part, the theories you explored in this course focused on Western cultures. Western cultures often are the baseline when conducting cross-cultural comparisons. Miao and Wang's (2003) article examining Chinese developmental psychology provides insight into how another culture examines human development.

While major developmental theorists and researchers (e.g., Gesell) influenced Chinese researchers, the topics of interest for Chinese researchers did not necessarily reflect those of Western researchers.

This course has introduced multiple perspectives and presented culturally diverse research examining all phases of human development. For this Discussion, consider what led research to be conducted to examine diverse settings and groups. Was it an attempt to broaden the population within which the findings could be applied, a reaction to a gap in the literature, or perhaps a critique of a conclusion or theory?

If you have not had an opportunity to delve into a statistics or methodology course, some of the techniques in this week's research articles might be confusing, but the process that the researchers used should be understandable.

To prepare for this Discussion:

• Review this week's Learning Resources and consider the applicability of American/Western developmental psychology to Non-Western countries and cultures.

Post your thoughts about the applicability of American/Western developmental psychology to Non-Western countries and cultures. Explain why it is important for developmental psychology to consider cross-cultural perspectives explaining human development. Justify your post with specific examples and citations from the Learning Resources. Use proper APA format and citations.

Discussion 2: Social Change Within Developmental Psychology

Throughout this course, you may have gravitated to certain stages of development and certain research topics. Perhaps you found cognitive development during early childhood particularly appealing.

Perhaps you are interested in the process of identity development during adolescence and the influence of culture. Maybe you want to learn more about how older adults cope with Alzheimer's disease.

There are endless questions and endless opportunities to affect change, improve human development, and positively impact the overall quality of life.

Take your curiosities and interests a step further and generate some ideas for positive social change in those areas. Do not limit yourself to what your current resources or capacities are; if you had ample resources at your disposal, what would you want to do to affect positive social change?

To prepare for this Discussion:

• Review the Walden University Social Change website and explore the possibilities for positive social change.

• Think about a research topic that involves lifespan development and how it could contribute to positive social change.

Post about a description of a research topic that involves lifespan development and explain how it could contribute to positive social change. Then, explain the actions you could take to bring about social change for that research topic possibility. Be specific.

Articles :

1. Differences and Deficits in Psychological Research in Historical Perspective: A Commentary on the Special Section By Michael Cole.

2 Human Developmental Science for Social Justice By Stephen T. Russell.

3. Some Long-Standing and Emerging Research Lines in Africa By Robert Serpell, Kofi Marfo.

4. Familism Through a Developmental Lens By Gabriela L. Stein, Alexandra M. Cupito, Julia L. Mendez, Juan Prandoni,Nadia Huq, and Diana Westerberg.

5. The development of adaptive competence: Why cultural psychology is necessary and not just nice By Robert J. Sternberg.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92409397
  • Price:- $20

Priced at Now at $20, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Assignmentspeculative design is the practice of theorizing

Assignment Speculative Design is the practice of theorizing about all possible futures, with special focus on those that are most likely, and trying to create designs and that might best benefit us in the future. This me ...

Question select a health care organization in your

Question: Select a health care organization in your community to conduct an interview with an appropriate risk management employee. The organization can be your current employer, or a different health care facility in yo ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

What is the difference between major and minor disruptive

What is the difference between major and minor disruptive behaviors in the classroom? Provide an example of each. What strategies do you plan to utilize to bring positive resolutions when major and minor disruptive behav ...

Questions1 what is the estimate of the marginal cost of the

Questions 1. What is the estimate of the marginal cost of the Phase 4 hospital services, given the case assumption that 60 percent of the designated costs are fixed and the remaining costs are variable? 2. Assume that th ...

Assignment -candidates must apply the irac principle when

Assignment - Candidates must apply the IRAC principle when answering each of the questions (i.e. I= Identify the key issues, R= Cite the relevant legislative provisions and case law (rules) where appropriate, A = apply t ...

Question define relative dating and radiometric dating

Question: Define relative dating and radiometric dating. Explain the similarities and differences between relative age dating and radiometric dating of rocks. Are there strengths and limitations of each?

Question one of the main objectives of this course is for

Question: One of the main objectives of this course is for you to examine your ethnic heritage, cultural identity, values, and assumptions and analyze their impact on the provision of culturally competent services; there ...

Discussionas social workers we will naturally have theories

Discussion As Social workers we will naturally have theories which we prefer over others. However, not all of our clients will naturally fit into these preferred theories. In these cases, we will need to use different th ...

Topic domestic violence risk assessment methodsadvantages

Topic: Domestic Violence Risk Assessment Methods Advantages and disadvantages of the various methods of risk assessment in domestic violence below: paper-based, interviews, clinical vs. actuarial. Make recommendations re ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As