Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Developing and Implementing Workplace Policy

SCENARIO & CONTEXT

Tom, one of your employees, has worked with your XYZ Tax Accounting firm for ten years. He is well liked and knowledgeable about the history of the office and IT systems. There is no past history of performance issues that you can see from looking at past performance reviews. But your workplace does not have a performance policy as well. What you have observed is that Tom regularly shows up late, (office opens at 8:30am, Tom usually comes by 9/9:15 am), takes longer than an hour for lunch, and often is heading out the door by 4:30pm (office closes at 5pm). You notice that this type of behaviour seems to happen once in a while for other employees in the office, but seems like a daily practice for Tom. He never records any of this time on his time card as official time off.

Another employee, Kelly who has recently joined the firm misses most of her weekly Tax reporting deadlines and submits them the week after. This creates a disruption to your office productivity and sometimes you have to personally deal with client complaints why the processing is taking too long.

A third employee, who is a young accountant in your firm has some behavioural issues. You have received three complaints in regards to his behaviour. Other staff members complained that he mocks using inappropriate language and sometimes he uses racist and sexist words when joking.

Since your organisation does not have a strict written policy in regards to performance, attendance and behaviour, you are now in the process policy/rule for everyone to follow.

TASKS

  • Make a policy statement mentioning the purpose of this policy for your organisation.
  • Develop at least 8 policy points/rules for the "Performance Attendance and Behaviour Policy" for this workplace in regards to performance, attendance and other expected behaviour. (Example: All staff members are to arrive at 9 am and sign the timesheet accordingly)

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92714155
  • Price:- $20

Priced at Now at $20, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Assignment selection strategy and weighted compensatory

Assignment: Selection Strategy and Weighted Compensatory Approach You are employed as an HR consultant for a mid-sized bank. The bank employs 200 tellers across its branches. You need to recommend to the bank what to con ...

Assignment - postera representational work printed a card

Assignment - Poster A representational work printed a card, canvas or similar medium for designed public display containing text and graphic elements. Topic - The Impact of Information Technology On Organizational Perfor ...

Risk assessmentan intruder attack can be labeled mild or

Risk Assessment An intruder attack can be labeled mild or serious. An intruder attack is labeled serious when an individual accesses confidential data, performs unauthorized modifications to data, or disrupts the system. ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question write a 1050- to 1400-word paper in which you

Question: Write a 1,050- to 1,400-word paper in which you examine clinical psychology. Address the following items: • Discuss the history and evolving nature of clinical psychology. • Explain the role of research and sta ...

Assignment careers in lodging and food and beverage

Assignment : Careers in Lodging, and Food and Beverage Industries To prepare for your assignment, review "Career Paths of a Hospitality Management Student". This article provides an overview of the various responsibiliti ...

Question 1 from the e-activity titled how mass media

Question: 1. From the e-Activity titled "How Mass Media Influences our Society" discuss two or three ways mass media influence you and others you know. Explain two or three reasons or ways in which mass media impact us. ...

What does it means to synthesize sources in a paper and how

What does it means to synthesize sources in a paper and how is synthesizing different from writing an annotated bibliography?

Question final projectthe international corporate

Question: Final Project The International Corporate Governance and Regulation module focusses on and critiques different approaches to corporate governance taken in various jurisdictions. Despite the different forms of c ...

Question describe an it or similar business project you

Question: Describe an IT or similar business project you have done or are currently doing. In your discussion, provide information on the following: 1. What is that project? Provide complete description. Consider using P ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As