Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Determine the correct answer of the given question

Question- The new owner of a student apartment building near campus was considering establishing a No Pets rule. He decided to survey the current residents to see how many owned pets and what kind of pets they owned. The building had 58 units. The previous owner had not allowed cats or dogs or other mammals, but the residents reported a variety of other pets: 30 owned birds, 38 owned fish, and 30 owned frogs, lizards, or snakes. Of those how had fish, 19 also had a frog, lizard, or snake.The owner found that 18 had both fish and birds and 15 kept a bird and a frog, lizard, or snake. Lastly, he determined that 10 owned fish, abird, lizard, or snake.

Part 1- How many residents could have reported no pets?

Part 2- How many residents owned a bird but not a fish?

Part 3- How many residents do not own a bird?

I need help to calculate the how many residents could have reported no pets and use Venn diagram to answer this question.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91256607

Have any Question?


Related Questions in Homework Help/Study Tips

Question details if possible interview a practicing hindu

Question: Details: If possible, interview a practicing Hindu individual or a leader of a Hindu temple, which can be used as an academic resource. If you would like to take pictures during your visit to this community or ...

Question prepare a 12- to 15-slide microsoftreg

Question: Prepare a 12- to 15-slide Microsoft® PowerPoint® presentation in which you explore your selected and faculty-approved contemporary issues from Week Three. Include the following in your presentation: • Definitio ...

Quesiton describe three take-aways that you are leaving

Quesiton: Describe three take-aways that you are leaving with this course; how will your new knowledge of careers and career management impact your future career? Are there any trends you see now or in the future that wi ...

Question cognitive science uses an empirical approach to

Question: Cognitive science uses an empirical approach to explore behavior and attempts to create models from observation of how people really act and behave. Some of the models found in cognitive sciences are: "Carl Ell ...

Question values culture and underlying beliefs of human

Question: Values, culture, and underlying beliefs of human services providers may raise dilemmas when handling cases involving issues such as infidelity, domestic violence, and parenting matters. In this week's media pro ...

Question application paper on sexual Question: Application: Paper on Sexual

Question: Application: Paper on Sexual Differentiation Hormones play a crucial role in shaping the fetal body into either a male- or female-typical body. The brain determines the type and amount of hormones the fetus pro ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question ethical resource allocationwork through the

Question: Ethical Resource Allocation Work through the simulation titled Resource Allocation from the end of Chapter 8 of your course text. Review the various options in the simulation, then select "Your Own Option" to t ...

Question note total 6 slides without including references

Question: Note: total 6 slides without including references with APA and without plagarism Part 1: Effect of Culture on Teams Review at least four academically reviewed articles on how cultures affect team management. De ...

What is dendrochronology how old are some of the trees on

What is dendrochronology. How old are some of the trees on earth?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As