Describe the significance of confidentiality and privacy in, Ask an Expert

Others

Confidentiality and privacy in the human resources

a) Describe the significance of confidentiality and privacy in setting up and maintaining the human resource files.

b) Describe and discuss in detail the laws which impact records management, like the American with Disabilities Act, HIPAA and Privacy Act of 1974.

View complete question

Homework Help/Study Tips, Others

Category:- Homework Help/Study Tips
Reference No.:- M930990

Have any Question?Write your Review or question?

Related Questions in Homework Help/Study Tips

Question in clinical settings advanced practice nurses

Question: In clinical settings, advanced practice nurses often encounter patients with blood disorders such as anemia. Consider the case of a 17-year-old girl who is rushed to the emergency room after suddenly fainting. ...

Chinese 10 questionsnbsp cosmology name1for ancient chinese

Chinese 10: Questions COSMOLOGY NAME: 1. For ancient Chinese, rather than Just being created out of nothing, how did the world (or universe) evolve? For ancient Chinese, what was "qi"? What is made out of "qi"? 2. Besid ...

Question short paper cultural sensitivity and

Question: Short Paper: Cultural Sensitivity and Intervention Based on Teaching Diversity: A Place to Begin, discuss the cultural sensitivity and intervention strategies used. Then, select a specific culture, and evaluate ...

Compare two different advanced registered nurse roles with

Compare two different advanced registered nurse roles with regard to ethical guidelines. Are there any differences in the ethical guidelines that govern these roles? What situations might require one role to respond diff ...

Question you will write two cultural experience reports

Question: You will write two cultural experience reports this session. You will hand in one during week 4 and the other during week 7. After each cultural experience, write a 500-800 word report about the visit and what ...

Question search the web for ethical standards in the human

Question: Search the web for ethical standards in the Human Services field, then find at least 5 Scriptures describing how we should treat others and care for them. Compare and contrast the Human Service ethics standards ...

Citations asa is preferred mla or apa is acceptableasa for

Citations: ASA is preferred, MLA or APA is acceptable. ASA for your text: Cohen, Philip N. (2018) The Family. Diversity, Inequality and Social Change. Second Edition. New York, NY. W.W. Norton & Company When it comes to ...

According to attached scenario design and implement a

According to attached scenario design and implement a simulation of datacenter topology for TeleNet service provider, specify the location of POPS, all technologies and protocols to be used and suggest how to enhance the ...

Discussion a very important aspect of healthcare

Discussion A very important aspect of healthcare administration is avoiding never events as these are termed. Give an example of a never event, and explain how you would respond to such an event taking place in your own ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Homework Help/Study Tips Expert