Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Defense in Depth                                      

Information security must keep information throughout the life span of the information, from the original creation of the information on through to the final disposal of the information. The information must be secluded while in motion and while at take it easy. throughout its life time, information may pass throughout many different information processing systems and through many different parts of information processing systems. There are many dissimilar traditions the information and information systems can be susceptible. To fully protect the information during its lifetime, each constituent of the information processing system must have its own fortification mechanisms. The building up, layering on and overlapping of security measures is called defense in depth. The power of any system is no greater than its weakest link.

Using a defense in deepness plan, should one suspicious measure fail there are other defensive actions in place that continue to provide safety.

Remember the previous discussion about logical controls, administrative controls, and substantial controls. The three kinds of controls can be used to form the bases upon which to build a defence-in depth-strategy. With this move toward, defence in depth can be conceptualized as three distinct layers or planes laid one on top of the additional. Additional approaching into defense in depth can be gained by philosophy of it as forming the layers of an onion, by means of data at the center of the onion, people as the outer layer of the onion, and network safety, host-based safety and applications security forming the inner layers of the onion. Both viewpoints are uniformly valid and each provides precious insight into the implementation of a good defense-in-depth strategy.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M9511259

Have any Question?


Related Questions in Homework Help/Study Tips

Questuon reflect on knapps stages this is a two part

Questuon: Reflect on Knapp's Stages. This is a two part assignment. Credit will not be given to assignments that do not meet the minimum word requirement. Read below for the two parts of this assignment: 1. Identify the ...

Question considering that some people seem willing to post

Question: Considering that some people seem willing to post just about any personal data on the Internet, how reasonable do you feel that the HIPAA rules for database security and the penalties for violations are? Please ...

What are the three ways in which heredity and environment

What are the three ways in which heredity and environment may be correlated, using examples from development?

A fan attending a soccer game slipped and fell on her way

A fan attending a soccer game slipped and fell on her way to the concession stand, breaking her leg. She sued the owner of the stadium and the concessionaire. At the trial, there was testimony that the concourse where th ...

Discussion spiritual development discussion in which you

Discussion: Spiritual Development Discussion in which you explain how considerations about clients' worldviews, including their spirituality or religious convictions, might affect your interactions with them. Provide at ...

Supermarket application objectivethis sef assignment has

SUPERMARKET application Objective This SEF assignment has two milestones designed to introduce students to various processes including the software engineering lifecycle, UML-design, refactoring and testing. The first mi ...

Question in this 2-3 page written assignment you will be

Question: In this 2-3 page written assignment, you will be exploring the legal and ethical parameters of the case manager and caring for clients with chronic illness or require transitional and/or end of life care. In th ...

Controlthe role of the microsystem in shaping childrens

Control The role of the microsystem in shaping children's effortful control is important and parents play a critical role. After reading the text and viewing the "Life at 3: Bad Behavior" video, address the following: Wh ...

Assignmentan individual who has been using a drug for an

Assignment An individual who has been using a drug for an extended period of time suddenly finds he is unable to secure more of the drug. He acts nervous and irritable and is hyperactive. He seems almost desperate to fin ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As