Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Cross-Cultural Research

Cross-cultural research is a method of study that psychologists use to compare data and behaviors of people from differing cultures, rather than a single culture. In cross-cultural research, you need to ensure that there is equivalence throughout the study, as well as a lack of bias in your measures, associations, and conclusions.

Equivalence is the evidence that your research uses the same techniques and measures to test the same phenomenon across cultures, and this equivalence helps your research to be considered valid and reliable. In addition to equivalence, you must be aware of the potential for personal bias in any cross-cultural research you conduct.

A bias is prejudicial predisposition that can prevent impartial thinking. In cross-cultural research, a bias can appear in various forms, such as the Barnum statement (a one-size-fits-all description) or the self-fulfilling prophecy (your assumptions about others can cause them to meet those expectations) (Matsumoto &Juang, 2008; Shiraev& Levy, 2010).

For this Discussion, perform an academic literature search in the Walden Library for a research study that includes specific cross-cultural research. Then, analyze the theoretical, methodological, and ethical issues included in the research study.
With these thoughts in mind:

A brief summary of the research study you selected, including the topic and conclusions of the study. Then explain any possible theoretical, methodological, and ethical issues involved in the study. Finally, share your thoughts about how, as a scholar-practitioner, you might address one or more of these issues. Support your responses using the Learning Resources and the current literature.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92241109

Have any Question?


Related Questions in Homework Help/Study Tips

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question explain the difference between an ascribed status

Question: Explain the difference between an ascribed status and an achieved status. Give examples of statuses that are mostly ascribed and those that are mostly achieved. Times New Roman 12 font, Please check spelling an ...

Question read the you be the judge on p 383 of the text it

Question: Read the "You Be the Judge" on p. 383 of the text. It is the case of Ridgaway v. Silk. Review the facts, and the arguments of each party in the case. Discuss: 1. the main issue(s) in the case (don't just reiter ...

Question the center point of research studies is the body

Question: The center point of research studies is the body of data collected to answer the research question. These data must be measured, which is the act of taking an abstract concept (e.g., depression, anger, etc.), s ...

Question do media distort representations of islam and arab

Question: Do Media Distort Representations of Islam and Arab Cultures?" Please respond to the following: Debate It - Take a position on this statement: The news media's depiction of Muslims negatively effects the way Ame ...

For this assignment you will take the perspective of a

For this Assignment, you will take the perspective of a director of a regional Environmental Protection Agency (EPA) office. The national EPA Office of Environmental Information (OEI) has tasked all regional directors to ...

Quesiton smart lab lessonsthe smartlab is a self-paced

Quesiton: Smart Lab Lessons The SMARTLab is a self-paced, online basic statistics course designed to prepare you for your graduate courses and graduate research. You will use the online primer in addition to this classro ...

Question 1 one by metallica shows a more serious side of

Question: 1. "One" by Metallica shows a more serious side of heavy metal. How does the music fit the lyrical content? What elements of the song show the band's influences? Who are they influential to? 2. "Rock Box" by Ru ...

Discussion - reseaerching careers and exploring through

Discussion - Reseaerching Careers and Exploring Through Experience Part 1: Read and Complete the Exercises for the following chapters Chapter 3: Researching Careers - Changing the Nature of Work - pages 63-96. Chapter 4: ...

Criminal profilingtext criminal profiling brent turvey 4th

Criminal Profiling Text: Criminal Profiling, Brent Turvey 4th Ed, Academic Press ISBN DQ & CT Chapter 12 Discussion Questions Why is it important for criminal profilers to determine whether multiple offenders were involv ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As