Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Conventional wars fought on the European models developed by Napoleon involve the leadership in writing and training troops for rules of engagement (ROE). Having ROE has brought both benefits and costs, and broadly training ROE at every level of leadership right down to the foot soldiers allows every participant to make responsible decisions and accomplish the mission as the battlefield commander has declared it. ROE is a management tool with benefits to keep situations under control and aligned with the mission. And yet the ROE in General Westmoreland's command placed precise limits on what could be done and how it could be done.

The chain of command links everybody in uniformed service to those both senior and junior to them, all the way from the most junior ranks up to the President of the United States. There are a great many levels, but for this assignment we are looking at only six levels.

Looking all the way up the chain of command from the infantry soldiers in Vietnam to the President, write a short paper that will correlate the understanding of ROE with the limited war ideology and its assumptions as seen through the perspective and experiences of the six levels. Write your paper as seen from the following six points of the chain of command (a paragraph for each level plus an introduction and conclusion should be about right):

individual soldiers in the field;
batallion commanders;
division commanders;
General William Westmoreland;
Secretary of Defense Robert McNamara; and
President Lyndon Johnson.

 

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92542547
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Quesiton reflect on the systems of compensation motivation

Quesiton: Reflect on the systems of compensation, motivation, and rewards that you learned in this course. Share your observations and reflections. The response must be typed, single spaced, must be in times new roman fo ...

Question objective design policies and procedures to

Question: Objective: Design policies and procedures to address the following areas: dynamic vulnerability analysis, intrusion detection, and incident response. The description should include the critical aspects of each ...

Question at the us census website find the poverty rate in

Question: At the U.S. Census website, find the poverty rate in your county code and entering your county in the Quick Start search bar. How does this "percent below poverty level" compare to the national rate? What facto ...

Management perspectives assignment -topic - bhp billiton

Management Perspectives Assignment - Topic - BHP Billiton company Learning Outcomes - Critically analyse the roles, functions that managers perform and discuss the challenges and risks they have to address in today's cha ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question for this visual analysis assignment you will

Question: For this Visual Analysis Assignment, you will choose one website that you visit frequently (it must be a professional business website, not your own personal website). Feel free to use websites such as Nike, Ap ...

Based on the material from the us department of justice

Based on the material from the "U.S. Department of Justice Forensic Examination of Digital Evidence: A Guide for Law Enforcement" document explain some important parts of the computer forensic process. Provide short and ...

Question first sectioncompensation strategies are developed

Question: First Section Compensation Strategies are developed to promote the goals of attracting, retaining, and motivating employees. Compensations policies at most organizations are based upon one of the following stra ...

Question topic we all had the unfortunate experience of

Question: Topic: We all had the unfortunate experience of seeing how computers can, at times, make life's journey abit more difficult. This is especially true in knowledge centric workplaces. Describe an example of a ver ...

Question what is your definition of spiritual care how does

Question: What is your definition of "spiritual care?" How does it differ or accord with the description given in the topic readings? Explain. The response must be typed, single spaced, must be in times new roman font (s ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As