Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Others


Home >> Homework Help/Study Tips

Compare-Contrast Essay

 

You wrote a rough draft of a Compare-Contrast Essay that examined a narrative and a descriptive essay to determine which style of essay was superior. This week you will complete the final version of your essay. Your Compare-Contrast Essay - Final Draft needs to be between 1500 and 1700 words and should have a thesis statement that clearly states what you are writing about. Your essay must:

1. Present several points of comparison and contrast in either block arrangement or point-by-point organization.

 

2. Incorporate the following:

 

a. A quote from one of the chosen essays.

b. A summary of a section of one of the chosen essays.

c. A paraphrase of a section from one of the chosen essays.

Conclude with a persuasive statement about which style of essay is superior based on the examples you selected. Make sure to address how the structure of the essay contributes to its superiority.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91392598
  • Price:- $30

Guranteed 24 Hours Delivery, In Price:- $30

Have any Question?


Related Questions in Homework Help/Study Tips

Assignment schizophreniaindividuals suffering from

Assignment : Schizophrenia Individuals suffering from schizophrenia may engage in violent behavior, which might cause them to become involved in the legal system. What are the overall symptoms of schizophrenia, and which ...

Question needs and uses of long-term care please respond

Question: "Needs and Uses of Long-Term Care" Please respond to the following: • Determine two (2) current needs and two (2) current uses of long-term care services. • Determine the main way(s) the overall needs and uses ...

Question this assignment is simply a more expanded

Question: This assignment is simply a more expanded exploration of your chosen topic for your Persuasive Researched Essay. You will answer the same questions, but with the added insight of your classmates' responses to y ...

Quesiton innate and adaptive immunitymelissa is a

Quesiton: Innate and Adaptive Immunity Melissa is a 15-year-old high school student. Over the last week, she had been feeling tired and found it difficult to stay awake in class. By the time the weekend had arrived, she ...

Assignment overviewfor this assignment you will learn what

Assignment Overview For this assignment you will learn what makes each culture and subculture unique. Sociologists use the "components of culture" in order to identify cultures and subcultures. The components of culture ...

What is the best way to create test measurements for a

What is the best way to create test measurements for a study that are both reliable and valid?

Writing assignments will be 2 pages 500 words1 at the top

Writing assignments will be 2 pages (500 words) 1. At the top of the page , Do a one sentence introduction to the assignment explaining what you're answering to, and a concluding sentence as well. 2. Format the document ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question culturally competent nursingfor this assignment

Question: Culturally Competent Nursing For this assignment, you will interview a person from a cultural background that is different from your own. Using the twelve domains of culture from the Purnell Model, discuss the ...

Assignment compensation analysis hr graduate classto obtain

Assignment: Compensation Analysis. HR graduate class. To obtain and retain the best and the brightest talent in an industry, an organization should pay particular attention to its compensation practices. With that a back ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As

Follow Us

© Copyright 2013-14 mywordsolution.com All rights reserved