Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Community-Based Immersion Learning Portfolio (CBIL)

The Community-Based Immersion Learning Portfolio (CBIL ) project is a semester long project you will work on at your own pace, due the last week of the course. Mental Health Counseling is a practice-based profession grounded in theory and research. You will need to attend/observe/participate in 6 learning experiences throughout the semester that are geared towards the practice of social work, counseling, or psychology with infants and toddlers. Some examples are:

· Observe an infant room at a child care center

· Interview a doula or birthing professional

· Attend a new parents group

· Observe an early intervention professional

· Observe/Volunteer at a baby play group

The opportunities are endless!

You will then reflect upon your experience by choosing 1 writing prompt to reflect and respond to regarding your experience. The writing prompts will posed soon. You may only use each writing prompt once.

These will all be kept as a "portfolio" and handed in at the end of the semester.

writing prompts :
1. Pick two theories from the course and reflect on how your experience either supported the assertions of the theory or challenged them?

2. Imagine you have a client with developmental delay or mental health issue in early childhood (or a parent). How would that effect your client's ability to engage in the experience you partook in? What would be some pros/cons of the experience for this particular client?

3. How do the aspects of the special needs theories discussed in this course apply to your experience? What programing within the experience supports the notions of the theory? (Please pick no more than 1 theory) You May Use Question 3 twice, as applied to two experiences, as long as you reflect on 2
separate theories!

4. List and discuss two ways that your experience fights against the assumptions imbedded in stigmas about your population or subpopulation? What would be some ways to further fight stereotypes through your experience?

5. What social barriers did you face while trying to access the experience? How would you imagine a client would handle these social barriers?

6. Discuss two ways you saw best practices utilized throughout the experience.

7. Based on research, theory, and your experience, discuss some pros/cons to the specific developmental stage that your experience is gaged for. Now discuss 3-4 ways to influence programming to account for the cons.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91361640
  • Price:- $75

Guranteed 36 Hours Delivery, In Price:- $75

Have any Question?


Related Questions in Homework Help/Study Tips

Lyric poetry uses metaphors and conceits to express deeply

Lyric poetry uses metaphors and conceits to express "deeply personal feelings" as it "unsettles, disturbs, and makes us wonder." Examining "The House of Yemanjá," identify places where Audre Lorde uses metaphors and show ...

Compulsory hurdle task skill buildingthis exercise is

Compulsory Hurdle Task: Skill Building This exercise is intended to give students an opportunity for orientation to academic writing, with feedback prior to graded assessments. Preliminary work for Assessment Task 1 will ...

Question consider the many means of differentiating

Question: Consider the many means of differentiating products and services. Which ones have the most impact on your buying decisions? Why? Bring an example of a brand that excels on this front. Your journal entry must be ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question examine the state of texas requirements for

Question: Examine the state of Texas requirements for practicum hours, for Professional Counseling students requirements in practicum hours. Does the program Professional Counseling you are enrolled in meet your state re ...

Question needs and uses of long-term care please respond

Question: "Needs and Uses of Long-Term Care" Please respond to the following: • Determine two (2) current needs and two (2) current uses of long-term care services. • Determine the main way(s) the overall needs and uses ...

Question select a disaster recovery plan drp for any

Question: Select a Disaster Recovery Plan (DRP) for any selected scenario. You can choose any organization's plan or create your own. 1. Describe the key elements of the Disaster Recovery Plan to be used in case of a dis ...

Question conduct an internet search about the murder of

Question: Conduct an internet search about the murder of Yeardley Love. After researching the story, write a 500¬-750-word essay addressing the following. 1. Assuming there was abuse occurring prior to the death of Yeard ...

1 there are four theories and we need choose two out of

(1) There are four theories and we need choose two out of them. (2) We need to write assumptions, individuals action and together action on each theory (3) How these theories can change policy- explain (4) And lastly we ...

Question journal - competencieseach week of this course you

Question: Journal - Competencies Each week of this course, you will be reviewing and reflecting upon the national competencies for health education specialists. There are seven areas of responsibility that you will revie ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As