Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Cognitive Dissonance Paper

Identify a situation in which an individual made a decision to engage in behavior that violated his or her values, beliefs, attitudes, and morals, such as calling in sick to work when he or she is not sick, speeding, or cheating on taxes.

Prepare a 1,100- to 1,400-word paper in which you analyze your identified situation. Address the following items:

Illustrate the situation and how the individual came to choose to make the decision that violated his or her ethics and morals.

Analyze the social, cultural, and spiritual influences on the individual's behavior. Consider the influences both for and against the decision.

Describe the reciprocal relationship between behavior and attitudes.

Explain cognitive dissonance and how the individual could have used cognitive dissonance theory to rationalize his or her behavior.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91391449
  • Price:- $23

Guranteed 24 Hours Delivery, In Price:- $23

Have any Question?


Related Questions in Homework Help/Study Tips

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Questionin this final section of the course we have

Question: In this final section of the course, we have discussed some of the "real" mysteries of archaeology and how archaeological knowledge progresses as well as alternative theories on conspiracy and cover-ups. Using ...

Psychology essay assignment - adolescent substance use

Psychology Essay Assignment - Adolescent Substance Use Disorders Treatment Approaches Paper Description - Write a 500- to 750-word opinion paper on what treatment approach seems best suited for adolescent substance use d ...

Question george clinton and parliament utilized business

Question: George Clinton and Parliament utilized business and artistic concepts from both James Brown and glam rock acts. How did this provide a unique approach to funk music? Are they influential to later acts? Are they ...

Question the patient is a 58-year woman diagnosed with

Question: The patient is a 58-year woman diagnosed with Stage IIIB breast cancer which required a mastectomy, chemotherapy and radiation treatments. She has a variety of chronic illnesses, including hypertension, diabete ...

Question bullyou are nearing the end of a long week in your

Question: • You are nearing the end of a long week in your community mental health outpatient counseling practice when your supervisor asks you to squeeze in an intake with an unexpected new client who walked in without ...

Question body weight regulation and anorexiaaccording to

Question: Body Weight Regulation and Anorexia According to data by the U.S. Centers for Disease Control, the United States has seen a dramatic increase in obesity with all states having 20% or more of their population be ...

Question write a 725-word paper describing an informal

Question: Write a 725-word paper describing an informal learning experience you have had. You may describe, for example, how you became afraid of heights, why a particular food or smell moves you emotionally, or why you ...

Charting your cultural awarenessthere are two parts to this

Charting Your Cultural Awareness There are two parts to this assignment: Describing your cultural awareness goals; and Charting action strategies for achieving these goals. Part One: The first part of this assignment pro ...

Question 1 what is technical communication how is technical

Question: 1. What is technical communication? How is technical communication different from other types of communication? Why is good technical communication imperative in today's diverse business environment? 2. Discuss ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As