Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Clinical and Administrative Information Systems

Health care organizations utilize a diversity of information systems to support and enhance the delivery of care to their patients. Although the specific types of information systems used vary by health care setting, the organizational activities supported by these systems fall broadly into two areas of functionality-clinical and administrative.

To prepare for this Application Assignment, review this week's Learning Resources. Then, select two types of clinical systems and two types of administrative systems of particular interest to you.

To complete this Application Assignment, write a 3-page paper in which you identify the health care setting (or context) in which each of the four specific systems you selected is used, describe the functional purpose of each system, and explain the potential benefits of each system for the health care organization.

Reading materials:

Video: Laureate Education (Producer). (2009). Introduction to health informatics: Clinical and administrative systems [Video file].

Course Text:Handbook of Informatics for Nurses and Healthcare Professionals

Chapter 6, "Healthcare Information Systems" (Read pp. 114-118, through "Monitoring Systems," and pp. 120-129, from "Laboratory Systems" through "Contract Management Systems.")

Article: Spooner, W. (2002). Order in chaos: Transforming best of breed solutions into integrated solutions.Health Management Technology, 23(10), 28-3 1.

Article: Rogoski, R. R. (2006). Counting on efficiency. Health Management Technology, 27(3), 10-14.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91781302
  • Price:- $35

Priced at Now at $35, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Assessment description this assessment aims to build

Assessment Description: This assessment aims to build analytical, team work and presentation skills. Students will form groups and will choose a country. Each group will provide a response to the question in reference to ...

Question explain how the four primary financial statements

Question: Explain how the four primary financial statements are used to describe an organization's financial performance. What is the most important financial statement and why? The response must be typed, single spaced, ...

After completing the lecture and reading assignments

After completing the lecture and reading assignments, develop a 750-1000 word written response paper to the following question. Do not use the question in your response. Health care rationing involves selecting, on some ...

Quesiton outline a mental health program to treat the

Quesiton: Outline a mental health program to treat the primary psychopathologies of mentally disordered offenders, including schizophrenia, major affective disorders, personality disorders (including psychopathy), brain ...

Evaluation of a business simulation the evaluation of a

Evaluation of a Business Simulation The evaluation of a business simulation is designed to relate the operation of a business department (s) in a simulation formation to the real world. It is also designed to relate clas ...

Assignment - regulationsselect a state regulation from a

Assignment - Regulations Select a state regulation from a state of your choice on one of the following topics. Prepare an annotated copy of the regulation including the sections you reviewed to answer the questions in th ...

Question in a formal paper of 1000-1250 words you will

Question: In a formal paper of 1,000-1,250 words you will discuss the work of the Robert Wood Johnson Foundation Committee Initiative on the Future of Nursing and the Institute of Medicine research that led to the IOM re ...

Marianin this scene the caregiver values belief and

MARIAN In this scene the caregiver values, belief, and expectation are embedded. The diverse environment is created for all children of culture. The caregivers are using "play" to help teach children to share and communi ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question please no plagiarism and make sure you are able to

Question: Please no plagiarism and make sure you are able to access all resource on your own before you bid. One of the references must come from James, R. K., & Gilliland, B. E. (2017). I have attached the document that ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As