Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Choose a type of Forensic Expert that would be required to testify in criminal court.

First describe how you would prepare for court and what you would wear.

Secondly, provide a minimum of 10 questions you would expect the prosecution to ask and a list of 10 questions you would expect the defense to counter with. (Do not forget Voir Dire questioning)

Thirdly, explain how you would prepare and present the evidence to the jury.

Finally, include an example of a court exhibit attached with your essay paper. Do not copy an image from the internet; work is to be your own creation.

Using your crime scene sketch from Project 1 or Fingerprint diagram from Project 2 isnot permitted.

Examples may include but are not limited to:

Diagram showing the basic characteristics used for identification for evidence such as fingerprints, firearms, paint, or hair

Mark-up of an enlarged photograph showing important details of a crime scene such as an aerial photograph showing the path taken by a suspect

Fingerprint Chart showing both the unknown and known prints that were compared.

Ballistics Chart showing 2 exhibits of ammunition that were compared.

short video narrating a mock crime scene of your choosing

The essay portion of this assignment is to be in APA format and a minimum of 2 pages in length. References are to be cited and all must be of appropriate academic quality.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92576696

Have any Question?


Related Questions in Homework Help/Study Tips

Question the greeks believed strongly in the concept of

Question: The Greeks believed strongly in the concept of fate, and that the gods who ordered the universe were in control of every human's destiny. But by the time of Sophocles, many were questioning the ancient wisdom. ...

Question in this assignment you will research

Question: In this assignment, you will research non-traditional labor markets related to recruiting as well as demonstrate skill in applying APA formatting for citations and references. This assignment assesses the modul ...

Course projectlast week you completed the literature review

Course Project Last week, you completed the Literature Review section of your paper. This week, you will complete the Description of the Program section of your paper, and then submit the work that you have completed to ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Essay assignment -this assignment is a summary the theme of

Essay Assignment - This assignment is a summary. The theme of the class is success. Relate ethics to success in a part of the summary. Format MLA and 2 pages.

Considering your chosen topic homeland securitywrite a two

Considering your chosen topic (Homeland Security), Write a two (2) page paper in which you: 1. Discuss how technologies or information systems have contributed to the problem. 2. Discuss how you will propose technology b ...

Question cognitive science uses an empirical approach to

Question: Cognitive science uses an empirical approach to explore behavior and attempts to create models from observation of how people really act and behave. Some of the models found in cognitive sciences are: "Carl Ell ...

Assignment application leadership concept analysis group

Assignment: Application: Leadership Concept Analysis Group Paper This week you will begin a group paper that you will develop over the next few weeks. By Day 3 of this week, you will be placed in a collaborative group an ...

Instructions considering the need for law enforcement and

Instructions: Considering the need for law enforcement and intelligence operations to complement one another, you have been invited as a guest speaker to delivers a 30-minute presentation that assesses how law enforcemen ...

Question comment 1phenomenological research refers to human

Question: Comment 1: Phenomenological research refers to human experience or perception relating to the proposed research topic (Grove, Gray, & Burns, 2015). This type of research helps to understand human behavior as th ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As