Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

By completing this assignment, you will be meeting Weekly Learning Outcomes 1, 3, and 4.

Overview

This week you will continue observing another stage of child development. Chapter 6 of your textbook describes the stages of physical, social, emotional, cognitive, and language development in toddlers one- to three-years old, including the developmental milestones and domains.

Use the textbook in addition to the video provided with the instructions for this assignment as resources. This assignment supports your knowledge of child development stages, domains and milestone, which you will use in your Week Five Final Paper.

Instructions

Read Chapter 6 of Early child development: From theory to practice and view the toddler observation video below. As you watch the video, take notes about what you observe related to child development. Next, write a paper that meets the following content and written communication expectations.

There is no narrative or dialogue in this video

Content Expectations/Content Criteria

Observation Summary : Summarize your observations from the Toddler Observation video.

Developmental Stages and Domains : Based on your observations, explain the stages and domains of development, including physical and motor development, social-emotional development, self-help development, cognitive development, and language development.

Typical Development : Discuss any concerns with the typical development that you observed in the toddler.

Development Support Strategies : Based on your observations and your desired professional role, explain how you might support this stage with developmentally appropriate practices. In addition, explain what elements your environment might include.
Written Communication Expectations

Page Requirement : Two to three pages, not including the title and references pages.

APA Formatting : Use APA 6th edition formatting, as outlined in the Ashford Writing Center, consistently throughout the assignment.

Syntax and Mechanics : Display meticulous comprehension and organization of syntax and mechanics, such as spelling and grammar.

Source Requirement : References the textbook and video resources for the assignment and at least two additional scholarly sources to provide compelling evidence to support ideas.

All sources on the references page need to be used and cited correctly within the body of the assignment.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92586052
  • Price:- $30

Priced at Now at $30, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question the acme auto insurance company is risk neutral

Question: The Acme Auto Insurance Company is risk neutral and seeks to offer insurance at its actuarially fair price. All drivers have the same initial income, $400, and if they are involved in an auto accident, their in ...

Question comment 1 there are many strategies that i can use

Question: Comment 1: There are many strategies that I can use to create change in my current workplace. One of them is to develop alliances and social support systems that can legitimize, nurture, and stimulate related c ...

Assignmentwrite a 700- to 1050-word paper describing the

Assignment Write a 700- to 1,050-word paper describing the forces of change and approaches to managing organizational change in criminal justice agencies, including identifying observable aspects of organizational cultur ...

To complete the application assignment analyze the articles

To complete the Application Assignment, analyze the articles from different perspectives. With the two articles in mind, use the attached Epidemiologic Study Worksheet to answer the following questions. The final workshe ...

Assignment research question and literature reviewyou will

Assignment : Research Question and Literature Review You will finalize the research question on a human services topic that you selected earlier in the course and conduct a literature review to better understand the prob ...

Question welcome to the unit vii discussion board be sure

Question: Welcome to the Unit VII discussion board! Be sure to read the unit lesson and reading assignments before posting so that they can inform your post. Begin by reading the unit lesson first. Have you ever seen Mir ...

Question suppose we want to create an address book which

Question : Suppose we want to create an address book which contains names, phone numbers, emails, and other personal information. In the questions below, give support to your answers based on the typical operations (for ...

Question one function of lipid is to provide energy glucose

Question: One function of lipid is to provide energy. Glucose is our body's preferred energy source, but fatty acids provide an alternative energy source when needed. Protein is the third essential macro-nutrient. This f ...

Write a 2- to 3-page paper excluding title page and

Write a 2- to 3-page paper (excluding title page and reference list) that includes the following components: Introduction Discuss the assumptions of the symbolic perspective. Describe some of the rituals or ceremonies in ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As