Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment

Why are services such as pollution control, postal service, public safety, and welfare programs appropriate for governmental programs and public administration? What are some of the changes that have occurred in major service areas over the past 5 years?

Is government closest to the people-city or county-more effective than state or federal government? Why? What are three issues you feel are important to public administrators today? Discuss one of these issues in detail.

Describe and evaluate a recent personal experience with government. What are the strengths and weaknesses of the process? What suggestions would you make for improvement?

What can public administrators learn from private sector management? What can private sector administrators learn from public sector management?

What are some differences between public and private sector planning? Why is broad public involvement important to the public planning process?

How do limited resources affect the public budgeting and administrative planning processes? What are the implications for the public administrator?

What public administration issues do you see? How might the issue (s) affect you or your community?

Share your thoughts: "Those who define public administration in managerial terms take a businesslike approach to it that tends to minimize the distinctions between public and private administration. In their view, public administration is essentially the same as big business and ought to be run according to the same managerial principles and values." Source: David H. Rosenbloom, Robert S. Kravchuk

Some believe that the United States has too many governments, in the sense that governmental authority is too fragmented and that the cost of redundancies and loss of coordination is too high. Would you favor abolishing any levels or kinds of government? Why or why not?

When you look around the various media outlets in your community, what public administration issues do you see? How might the issue (s) affect you or your community?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92809164
  • Price:- $55

Priced at Now at $55, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question family therapy courseplease put the question or

Question: Family Therapy Course Please put the question or section name above each paragraph Create a concept map of the workings of neurons and neurotransmitters from the subject of psychopharmacology. Your concept map ...

Question instructions watch victor rios ted talk help for

Question: Instructions: watch Victor Rios' TED Talk, Help for Kids the Education System Ignores write a response paper reflecting on how social stratifiers (in this case, race, and class) impact kids' access to and achie ...

Question servant leaders must be internally consistent with

Question: Servant leaders must be internally consistent with their words and actions. Describe a mentor that you have had that displayed this kind of credibility. Share an example of what you witnessed from this person. ...

Question describe the interference of a god or goddess in

Question: Describe the interference of a god or goddess in influencing a particular choice facing a human character in Book I of The Iliad. By analyzing direct quotations of Homer's language, explain how the god or godde ...

Please identify and fix passive voicewuthering heights is a

Please identify and fix passive voice? Wuthering Heights is a classic work of literature that matches with various elements of Victorian literature particularly through the theme of love. Romantic love takes several form ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question what is your idea of the american dream is it

Question: What is your idea of the "American Dream?" Is it attainable in today's society, or just a dream from your parents' generation? This essay needs to be 3 pages long. Since it is an opinion essay, there is no need ...

To ys as agents of socializationwritten assignment toys as

To ys as Agents of Socialization Written Assignment: Toys as Agents of Socialization Take a trip to your local toy store or a large department store with a toy section. Address each of the following questions with regard ...

Assignment affirmative actionaffirmative action is a

Assignment : Affirmative Action Affirmative Action is a controversial topic in American society. People of all races, genders, and classes are divided on where they stand on Affirmative Action. However, the media has ove ...

Question research the functions importance and role of fat-

Question: Research the functions, importance, and role of fat- and water-soluble vitamins. Create a 12- to 15-slide Microsoft® PowerPoint® presentation that includes the following: • A title slide • An introductory slide ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As