Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment

PART I ESSAY, Maximum Word Count 300

You are a wealthy art collector and want to purchase TWO works for your French chateau. Choose one realistic work and one abstract work from the Art Institute Dicke Wing. Give the name of the artist, the title, date and medium for each of the two works of art you have selected.
Follow the guidelines below to complete your essay.

Select from the list of works below.

Realistic/Representational
Abstract
Wiley, Honorable Augustus Keppel
Hofmann, Enchanted Fire
Porter, Self Portrait
Frankenthaler, Sea Change
Fish, Embroidery Uzbekistan
Warhol, Russell Means
Kienholz, Sawdy
Raushenberg, Sling Shot
Van Pelt, Louise
Nevelson Nevelson, Untitled
O'Keefe, Purple Leaves
Yoshitomo, Flying Pup

Your essay's main focus should be the discussion of the visual elements (refer to the Study Terms) in each work; how the visual elements support content and meaning in the work; and brief biographical information on the artists. If the work has a label, you may use the information in the label if it is appropriate to your essay, but it has to be expressed in your own words.

For each image comparison below, write (at the beginning of your essay) each artist's name, title of work, medium, date and style (25 pts)

PART II ESSAY Maxmum Word Count 100

Compare and contrast luminist Albert Bierstadt Scene in Yosemite Valley with American Impressionist Childe Hassam, Early Morning Calm. Give a visual analysis of each work, including discussion of the formal elements (refer to Study Terms); how the visual elements support content and meaning in the work.

You would want to compare and contrast significant features relating to subject and/or style, making sure to note any factors that explain the artists' preferences (influences in the art world or encounter with the larger culture/s, personal experiences or background).

PART III ESSAY Maxmum Word Count 100

Compare and contrast Joan Mitchell's Untitled with one of the Chinese landscape scrolls in the Dayton Art Institute Asian Wing. Your essay's main focus should be a discussion of the visual elements; how the visual elements support content and meaning in the work.

PART IV ESSAY Maxmum Word Count 150

Select one object (your choice) from the museum collections in any of the DAI Galleries (i.e., African, Asian, Greek, American, etc.). Describe the object in detail, using formal elements.

Clearly identify the narrative of the work (painting, sculpture) and/or the use of the object (esp. ceramics, ceremonial objects, etc)?

FOCUS your essay on what you OBSERVE through CLOSE LOOKING, and what you can then infer about context/geography/socio-cultural/political context from your observations?

You will need to submit a 5" x 7" photograph or drawing of your chosen works.

Follow the guidelines listed below for essay format:

1 . Your essays should be typed or word-processed, have one-inch margins and numbered pages. Each essay should be double-spaced. Type size 12.

2. Spelling, punctuation, grammar and writing style will count in the grading process! All sources must be cited. Use the MLA handbook, available in the bookstore, library, Online. BE SURE TO INCLUDE A WORKS CITED PAGE. I remind everyone that those caught using large portions of any published research, including websites and audio/visual sources, that do not properly cite in MLA or Chicago Manual of Style will receive an automatic zero. If in doubt, always CITE!

Select one work (your choice) that you do not like from the museum collection in any of the DAI galleries. Give a visual analysis using your Study Terms and explain how the visual elements support meaning in the work.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92065268
  • Price:- $40

Priced at Now at $40, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question the center point of research studies is the body

Question: The center point of research studies is the body of data collected to answer the research question. These data must be measured, which is the act of taking an abstract concept (e.g., depression, anger, etc.), s ...

Assignmentimagine that you are the clinic manager of an

Assignment Imagine that you are the clinic manager of an urgent care center. Recently, your center has seen an increase in complaints regarding long wait times, inadequate or incomplete information from staff during visi ...

Assignmentwrite two pages of reflection on josef piepers

Assignment Write two pages of reflection on Josef Pieper's "Leisure: The Basis of Culture." Questions to answer include, what is leisure? How can we find leisure in a world obsessed with work? Do film and video games ser ...

Question describe an it or similar business project you

Question: Describe an IT or similar business project you have done or are currently doing. In your discussion, provide information on the following: 1. What is that project? Provide complete description. Consider using P ...

Instructionsquiz 1 will have three separate sections1

Instructions Quiz 1 will have three separate sections: 1. Questions related to programming terminology, associated artefacts and actions. 2. Hand execution questions, where you demonstrate what changes in memory as some ...

Discussion question pierre bourdieu coined the term

Discussion Question : Pierre Bourdieu coined the term "cultural capital" to refer to the unique cultural values, knowledge, and skills associated with the upper classes. Discuss the role cultural capital plays in reprodu ...

Question redistribution of income occurs through the

Question: Redistribution of income occurs through the federal income tax and government antipoverty programs. Explain whether or not this level of redistribution is appropriate and whether more redistribution should occu ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question as a group observe the simulated home visit with

Question: As a group, observe the simulated "Home Visit With Sallie Mae Fisher" video. Refer to "Sallie Mae Fisher's Health History and Discharge Orders" for specifics related to the case study used to inform the assignm ...

Question identify and research two event scenarios where

Question: Identify and research two event scenarios where you think integrated marketing communications (I.M.C.) have been deployed well. What was done well for each scenario and why was it important to the success of th ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As