Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment

Organizing Your Approach Throughout this course, you have explored the principles of motivation, how to create a motivating environment for young people, and how to guide children and adolescents through conflicts, problems, and other social-emotional challenges.

You have examined models and techniques that professionals might use to organize their approaches toward motivating and guiding young people in group or classroom settings. In this Discussion, you will consider how you might apply the concepts and strategies you have learned about in this course in a professional setting and how you might integrate these strategies into your own custom approach. Reflect on the following:

• In what setting(s) involving school-age children and adolescents do you currently work or anticipate working in the future? What is-or will be-your role as a professional?

• How might you organize your approach to motivating and guiding the children and/or adolescents with whom you work? What concepts from this course might you focus on especially? Why?

• What specific motivational and/or guidance strategies might you use in your approach, and why? How might you implement them? Which ones might you not use? Why? With these thoughts in mind, follow the instructions below to post your response to this Discussion topic. By Wednesday: Post a description of the setting you work in or plan to work in with children and adolescents.

Then explain how you might apply the concepts and strategies you have studied in this course in this setting. Identify and describe at least three specific strategies you might use (including if and how you might customize them for your context), when and how you would implement them, and why.

Then describe one strategy you do not think would work well in your setting and explain why. Be sure to cite information from the Learning Resources to support your thinking.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92478471
  • Price:- $20

Priced at Now at $20, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

American government 1explain the concept of checks and

AMERICAN GOVERNMENT 1. Explain the concept of checks and balances as it relates to the sharing of power. Your response should consist of at least 75 words. 2. Differentiate between the Federalists and federalism. Your re ...

Question using approximately 200-500 words and general

Question: Using approximately 200-500 words and general American Psychological Association writing format (one-inch margins, 12-point font, double spacing, third person language), respond to the following questions: - Pr ...

Question professional reflection1please reflect on what you

Question: Professional Reflection 1. Please reflect on what you have been undergoing during the first few weeks as a new graduate registered nurse 2. Tell me what you anticipate to be your greatest struggles? 3. Your gre ...

Big data and analytics assignment - analytic report and

Big Data and Analytics Assignment - ANALYTIC REPORT and PRESENTATION Analytic Report Purpose: The purpose of this task is to provide students with practical experience in working in teams to write a Data Analytical repor ...

Assesment 1 assessing the abdomenbdomena woman went to the

Assesment 1: Assessing the Abdomenbdomen A woman went to the emergency room for severe abdominal cramping. She was diagnosed with diverticulitis; however, as a precaution, the doctor ordered a CAT scan. The CAT scan reve ...

Big data and analytics assignment - analytic report and

Big Data and Analytics Assignment - ANALYTIC REPORT and PRESENTATION Analytic Report Purpose: The purpose of this task is to provide students with practical experience in working in teams to write a Data Analytical repor ...

Question in spring 2017 ten newly admitted harvard students

Question: In Spring 2017, ten newly admitted Harvard students had their admission offers rescinded. The students had posted inappropriate memes and messages online. If you are unfamiliar with this incident, you can revie ...

Question declarative and procedural memoriesthe case of

Question: Declarative and Procedural Memories The case of Henry Molaison (H.M.) presented in this week's readings demonstrates the impact memory loss can have on an individual's life. Through H.M.s tragic loss, scientist ...

Question complications of asthma can be sudden consider the

Question: Complications of asthma can be sudden. Consider the case of Bradley Wilson, a young boy who had several medical conditions. He appeared in good health when he went to school, returned home, and ate dinner. Howe ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As