Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment

INTERSECTIONS

With the numerous school shootings over the last two decades, especially in America as this is chiefly an American thing, one may wonder - What is the cause of all these shootings, and what can be done about the problem? Is there some root thing worth targeting, or has some perfect storm been created now-beyond our powers to stop it-and we should just accept frequent shootings as the price of living in America? In an essay of 800-100 words you must answer the question Should guns be allowed on college campuses? (if you choose to, you may also include lower school). Three essays should be read in preparation: The first is Timothy Wheeler's "There's A Reason They Choose Schools." The second is Malcolm Gladwell's "Thresholds of Violence: How School Shootings Catch On" [link available in Web Links at the bottom of Modules, or by Googling]. The third is Jesus M. Villahermosa's "Guns Don't Belong in the Hands of Administrators, Professors or Students" [Google it]. Your essay must be in MLA format again - a checklist has been available this time in Modules/ Course Documents. Your work must have 5-7 outside sources. You must use at least one of the required readings, and may use all three.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92537151

Have any Question?


Related Questions in Homework Help/Study Tips

In order to obtain informed consent from a client the

In order to obtain informed consent from a client, the psychologist must provide sufficient information to the client that would allow them to make a decision about whether they want to enter the therapeutic relationship ...

For this assignment you can use your current social media

For this assignment, you can use your current social media accounts, or create new ones, as you reflect on the significance of the Internet and social media and what it means for you. Write a 350- to 700-word summary des ...

Read the article titled police foil 420 million keylogger

Read the article titled: "Police Foil $420 Million Keylogger Scam" found on the eWeek. Write a 3-4 page paper in which you: Give an example of the measures, you believe, the government or society can implement to deter t ...

Question cultural development exerciserequirements - this

Question: Cultural Development Exercise Requirements: - This is a 3-5 page paper. (You will need to answer all questions fully). - You should have a MINIMUM of three sources for this paper. (You may use the videos we wat ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Answer the following question identify and discuss the five

Answer the following Question : Identify and discuss the five periods of juvenile justice history and which period you think was the most influential to the evolution of the juvenile justice system. The response must be ...

Question topics 1windows and the threat landscape2security

Question: Topics: 1. Windows and the Threat Landscape, 2. Security in Microsoft Windows OS 3. Access Controls in Microsoft Windows 4. IoT (Internet of Things).MDM systems and BYOD policies 5. Ransomware 6. Protecting Mic ...

Discussion questions there are multiple threats vectors to

Discussion Questions: There are multiple threats vectors to the world's maritime transportation system (MTS) and their associated ports from small boat attacks to the possibility of CBRNE attacks. For this forum, conside ...

Question eln purchased a used for a 10000 she whole a check

Question: Eln purchased a used for a $10,000. She whole a check for $2,000 as a down payment for the car and financed the $8,000 balance. The annual percentage rate a 12% compounded monthly and the loan is to be repaid m ...

Question primary task response within the discussion board

Question: Primary Task Response: Within the Discussion Board area, write 800 words that respond to the following questions with your thoughts, ideas, and comments. This will be the foundation for future discussions by yo ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As