Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment

In 2001, the American College of Emergency Physicians (ACEP) formed a coalition called "The Partnership for Community Safety: Strengthening America's Readiness." The focus of the partnership was to strengthen the healthcare community's response to disasters. It brought together several healthcare organizations in an effort to work together toward this goal. Choose an organization that is a part of this movement, and prepare a paper on the organization. In your paper, include the answers for the following points:

• A brief historical background of the organization

• The main purpose and the role of the organization

• Any regulatory requirements or guidelines, which the organization formulated for disaster preparedness

• Any experience the organization has had with the disaster response

• Any legal or ethical issues that the organization has encountered with regard to emergency preparedness

• Any training the organization conducts for emergency preparedness

• Any other issues found during online research

Using South University Online Library or the Internet, research on the topic "The Dark Winter Experiment." On the basis of your research and your understanding of the topic, answer the following questions:

• What was the Dark Winter experiment? Why was this experiment important?

• How has the experiment helped us today in dealing with an emergency response?

Submission Details

Combine your responses in 4-page not counting the cover page or the reference page.

Support your responses with reasoning and examples.

Cite any sources in APA format.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92761396
  • Price:- $40

Priced at Now at $40, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question for this draft you may choose between the genres

Question: For this draft, you may choose between the genres of fiction and creative nonfiction. Whichever genre you choose, you should focus on developing a suggestive settingand interesting story. Remember to also inclu ...

Wtch the video provided then answer the questionsvideo

Watch the video provided, then answer the questions. Video : How to make stress your friend By Kelly McGonigal | TEDGlobal 2013 Consider the information you have learned in class so far. Also consider after watching the ...

Question present a possible cultural challenge that you

Question: Present a possible cultural challenge that you have identified in your multicultural workforce and/or patient care. Reflect and answer the following questions: When has culture been a factor in care of a patien ...

Question another growth opportunity has arisen for blujay

Question: Another growth opportunity has arisen for BluJay Aviation and the company has asked for your business consulting company's advice.A company giving scenic rides over the city in a helicopter has decided to close ...

Accounting concepts and applicationsstudents are required

Accounting Concepts and Applications Students are required to complete the computerised accounting practice set - World of Games - by Pabst and Perrin (2015) on an INDIVIDUAL basis for accounting transactions up to Perio ...

Case assignmentafter reading the background materials as

Case Assignment After reading the background materials as well as additional information you find from the literature and online sources, respond to the following: Explain how Medicare is financed. Identify who is eligib ...

Situation analysis general descriptionthe goal of this

Situation Analysis : General Description The goal of this assignment is for you to bring together what you have learned about thinking about a problem that affects health/well-being from a broader public health perspecti ...

Lyric poetry uses metaphors and conceits to express deeply

Lyric poetry uses metaphors and conceits to express "deeply personal feelings" as it "unsettles, disturbs, and makes us wonder." Examining "The House of Yemanjá," identify places where Audre Lorde uses metaphors and show ...

Lab activity - faraday inductiondirections -1 getting

Lab Activity - Faraday Induction Directions - 1. Getting started. Open the website listed above and on the top of the screen select the tab marked Pickup Coil. 2. Make observations & draw conclusions. Add a field meter t ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As