Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment

Diversity Training Manual: Part IV

As the new manager of human resources, you are preparing the next section of the diversity training manual, which focuses on making supervisors more aware and sensitive to religious discrimination issues.

This section of the training manual should include the following information:

• Give an explanation of the Civil Rights Act, Title VII 1964 legislation, dealing specifically with the meaning of reasonable accommodation for religious practices.

o Read the Civil Rights, Title VII 1964 legislation.

• For each of the 3 religious groups listed, describe and explain the following:

o Include at least 2 religious practices that could easily be accommodated by management without any hardship for the company.
o Include at least 2 practices that would be difficult to accommodate.

The 3 religious groups you will be examining are as follows:

• Orthodox Jewish
• Hindu
• The Church of Jesus Christ of Latter-Day Saints

Part V:

As the human resources manager, you are now ready to complete your diversity training manual to be used for training and sensitizing your employees on diversity issues. This final section will cover actual legislation. You would like your employees to not only be aware of issues dealing with discrimination that may not be addressed in legislation (the moral component) but to be knowledgeable of the seriousness of the discriminatory practices that have been made into law.

Affirmative Action is one of the most contentious issues; its intent and the discriminatory result of applying it in practice has become a major issue in today's workforce.

Using this Web site (or any others you find), write a paper of 4-6 pages that will summarize the following points and become part of the training manual:

• What is Affirmative Action?
• What was the initial intent of Affirmative-Action legislation?
• What did the landmark Bakke v. Regents case conclude? Click here to read the case.
• What was the basis for the conclusion?
• What are the positive and negative results of Affirmative Action legislation?
• In your evaluation, is Affirmative Action legislation is still appropriate?

References

Ball, H. (2000). The Bakke case. Lawrence, KS: University Press of Kansas. Retrieved from http://lilt.ilstu.edu/gmklass/pos334/archive/ball.htm

Civil Rights Act, 42 U.S.C. § 2000e (1964). Retrieved from http://finduslaw.com/civil-rights-act-1964-cra-title-vii-equal-employment-opportunities-42-us-code-chapter-21

University of California Regents v. Bakke, 438 U.S. 265 (1978). Retrieved from the FindLaw Web site: http://caselaw.lp.findlaw.com/cgi-bin/getcase.pl?court=US&vol=438&invol=265

Submitting your assignment in APA format means, at a minimum, you will need the following:

1. TITLE PAGE. Remember the Running head: AND TITLE IN ALL CAPITALS

2. ABSTRACT. A summary of your paper...not an introduction. Begin writing in third person voice.

3. BODY. The body of your paper begins on the page following the title page and abstract page and must be double-spaced (be careful not to triple- or quadruple-space between paragraphs). The type face should be 12-pt. Times Roman or 12-pt. Courier in regular black type. Do not use color, bold type, or italics except as required for APA level headings and references. The deliverable length of the body of your paper for this assignment is 4-6 pages. In-body academic citations to support your decisions and analysis are required. A variety of academic sources is encouraged.

4. REFERENCE PAGE. References that align with your in-body academic sources are listed on the final page of your paper. The references must be in APA format using appropriate spacing, hang indention, italics, and upper and lower case usage as appropriate for the type of resource used. Remember, the Reference Page is not a bibliography but a further listing of the abbreviated in-body citations used in the paper. Every referenced item must have a corresponding in-body citation.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92023999

Have any Question?


Related Questions in Homework Help/Study Tips

Assignment specificationquestion 1hint we cover this in

Assignment Specification Question 1 HINT: We cover this in Lecture 1 (Summary Statistics and Graphs) Data were collected on the prices of parts at each shelf in auto parts showroom in Melbourne. The prices of parts at ea ...

Question read the you be the judge on p 359 of the text it

Question: Read the "You Be the Judge" on p. 359 of the text. It is the case of Gulino v. Board of Education of the City School District of New York. Review the facts, and the arguments of each party in the case. Discuss: ...

Who was the most interesting philosopher during the

Who was the most interesting philosopher during the renaissance and What were his commitment and challenge to the birth of science?

Question vaccine controversies have occurred since almost

Question: Vaccine controversies have occurred since almost 80 years before the terms vaccine and vaccination were introduced, and continue to this day. Despite scientific consensus that recommended vaccines are safe and ...

Throughout this course you will be developing a framework

Throughout this course, you will be developing a framework to bring focus to areas of concern for the enterprise to take action toward implementing best practices for network security. The weekly Individual Project assig ...

Assignmentvarious categories or types of law exist within

Assignment Various categories or types of law exist within the United States. Identify and define three different types or categories of law. Compare and contrast how these various types or categories of law impact the c ...

Question sustaining change can be difficult as there are

Question: Sustaining change can be difficult, as there are many variables that can affect implementation. One critical component of EBP is to ensure that practice change is part of an organization's culture so it will co ...

Question bullwhat is nafta under what president was nafta

Question: • What is NAFTA? Under what President was NAFTA formed and why? • What countries are linked? What are the advantages and disadvantages of the trade agreement? • Define reshoring. • Discuss why leaders are decid ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Game design and productionassignment game design

Game Design and Production Assignment : Game Design Documentation This is a group assignment; you will work in teams of 3-4 students (from the same tutorial group). Your task is to produce detailed design documentation f ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As