Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment: Code of Conduct Assessment

Refer the following resources to complete this assignment:

Note: The assignments are a series of papers that build upon one another.

Raytheon's code of conduct
(http://www.raytheon.com/responsibility/rtnwcm/groups/public/documents/content/rtn_ethics-code.pdf)

Examples of Procurement Fraud

(http://cporising.com/2012/08/03/examples-of-procurement-fraud/)

The recent emphasis on ethics in government contracting requires contractors to avoid any conduct that even appears to be unethical. Imagine you are a former contracting officer (CO) turned contractor (you choose your area of expertise) and you just created a new contracting firm.

Write a four page paper in which you:

-Provide an explanation of the specific goods and / or services the new contracting firm will provide.

-Evaluate the Raytheon Code of Ethics as to whether it is effective in avoiding any conduct that even appears to be unethical in the type of organization you selected for your product.

-Determine the three most critical clauses in the Raytheon document that aid the company's avoidance of the appearance of impropriety.

-Determine two additional ethics provision that you would include in your company's Code of Conduct document based on Raytheon Code of Ethics. Explain the rationale for the inclusion.

-Analyze how your recommended clause sufficiently closes the gap on one potential major ethical breach in the industry to which your product belongs. Note: Be sure to address any areas of concern regarding potential fraud in the contracting process.

-Use at least three quality resources in this assignment. Note: Wikipedia and other Websites do not qualify as academic resources.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91419202
  • Price:- $40

Priced at Now at $40, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question health information technology health it makes it

Question: Health information technology (health IT) makes it possible for health care providers to better manage patient care through secure use and sharing of health information. Health IT includes the use of electronic ...

Question well-written project documentation clarifies

Question: Well-written project documentation clarifies intent, documents decisions and results, and allows project managers to assess project progress (and report it, as necessary, to project stakeholders) at every step ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Iahessay questions1 first describe and explain singers

IAH:Essay Questions [1] First, describe and explain Singer's overall argument for the claim that we have a very (surprisingly) large obligation to give to the global poor. Second, write a paragraph where you give the bes ...

Question 1 read about the measure and pivot or persevere

Question: 1) Read about the Measure and Pivot or (Persevere)" chapters from the Lean Startup" book for Eric Ries. You need to write with your style your own brief summary about: What is the chapter about? What are the le ...

Question 4-1 you decide to invest 100000 in a program that

Question: 4-1. You decide to invest $100,000 in a program that is guaranteed to grow by 2.5% for each of the next 5 years. At the end of the 5 years, how much is your investment worth? 4-2. What is the effective annual r ...

Assignment detailswhat is a revocation hearingexplain the

Assignment Details What is a revocation hearing? Explain the steps involved in a revocation hearing and what rights the offender has.

Applied business research assignment -assessment - research

Applied Business Research Assignment - ASSESSMENT - Research Plan, short response This assessment is designed to allow students to develop the expertise necessary to formulate practical and usable research questions to r ...

Question details create a living guide of coaching steps

Question: Details: Create a "living guide" of coaching steps that a life coach would use in an initial session to assist in building a road map with the client (review the text on pages 47 - 55 for steps). In 750-1,000 w ...

Sdvmonica has a biology mid-term exam on thursday on the

SDV Monica has a Biology mid-term exam on Thursday. On the night before the exam, Monica has a hard time falling asleep and when she does, she has various nightmares about taking tests. The day of the exam, Monica decide ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As