Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment 2: Process Recordings

A process recording is a written tool used by field education experience students, field instructors, and faculty to examine the dynamics of social work interactions in time. Process recordings can help in developing and refining interviewing and intervention skills. By conceptualizing and organizing ongoing activities with social work clients, you are able to clarify the purpose of interviews and interventions, identify personal and professional strengths and weaknesses, and improve self-awareness. The process recording is also a useful tool in exploring the interpersonal dynamics and values operating between you and the client system through an analysis of filtering the process used in recording a session.

For this Assignment, you will submit a process recording of your field education experiences specific to this week.

Please use the attached template as a formatting guidance.

The Assignment: (2-4 pages)

- Provide a transcript of what happened during your field education experience (Air Force Military Mental Health Clinc, including a dialogue of interaction with a client.

- Explain your interpretation of what occurred in the dialogue, including social work practice or theories, and explain how it might relate to assessment covered this week.

- Describe your reactions and/or any issues related to your interaction with a client during your field education experience.

- Explain how you applied social work practice skills when performing the activities during your process recording.

References (use 2 or more)

Birkenmaier, J., & Berg-Weger, M. (2018). The practicum companion for social work: Integrating class and fieldwork (4th ed.). New York, NY: Pearson.

Chapter 2, "Socialization into the Social Work Profession" (pp. 34-61)

Gerdes, K. E., & Segal, E. (2011). Importance of empathy for social work practice: Integrating new science. Social Work, 56(2), 141-148.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92750850
  • Price:- $25

Priced at Now at $25, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question please read directions fieldwork essaykinesics the

Question: Please read directions: FIELDWORK ESSAY KINESICS: the study of body motion or body behavior. • Emblems: gestures that have a direct verbal translation and can stand alone such as the "ok" sign. • Illustrators: ...

Instructionsjournal using the pennebaker et al article

Instructions Journal: Using the Pennebaker et al. article address the following questions in your journal. o Is this study an observational study or a randomized experiment? Provide support for your response. o To the be ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question topic substance abuse opioids epidemic

Question: Topic( Substance Abuse, Opioids Epidemic) PowerPoint Identification of the social problem with research supporting the background presented. 1. You must demonstrate that this social problem exists by communicat ...

Question the greeks believed strongly in the concept of

Question: The Greeks believed strongly in the concept of fate, and that the gods who ordered the universe were in control of every human's destiny. But by the time of Sophocles, many were questioning the ancient wisdom. ...

Assignment -prepare 11 slides presentation on given

Assignment - Prepare 11 Slides presentation on given project. Project - Development of fingerprint in voting system Goals: The main goal of the project is to develop fingerprint voting system in order to given the facili ...

Question present your assignment in an apa format word

Question: Present your assignment in an APA format, word document, Arial 12 font . A minimum of 2 evidence-based references is required. A minimum of 600 words is required. 1. Identify and discuss the types of disasters. ...

Question what was the significance of translating the bible

Question: What was the significance of translating the Bible into vernacular languages (English, French, German)? Describe some of the efforts to translate the Bible into English. What was the importance of Luther's Germ ...

Assignment -the topic chosen is molecular biologyproject

Assignment - The topic chosen is molecular biology. Project Outline and Project Development Paper - Part I: Project Outline This assignment is a step by step explanation of how your project will be developed from beginni ...

You need an outline for an independent research in business

You need an outline for an independent research in Business Organization class. The paper is going to be comparative research between the US legal system and European Union. Here are the subject and some point to be comp ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As