Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment 2: LASA 1-Designing Compensation Systems

When designing a compensation system for an organization, it is important to have a compensation philosophy which serves as a framework for making decisions about various components of the system.

Tasks: One question to be addressed is how can your compensation program help the organization be successful (e.g., be able to attract and retain talented workers needed to be competitive in the marketplace)?
Some options for consideration include:

• Being an "employer of choice" in the industry

• Offering top salaries

• Putting more emphasis on benefits and less on salaries

• Establishing "pay for performance" systems

• Offering flexible in work hours, shifts, work rules, dress code, professional development/education policies

• Offering designer benefits

• ESPP (Employee Stock Purchase Plans)

Write an 8-10-page report discussing what factors you think should be considered when creating a compensation system for an organization and why. Include the organization you work for (past or present) and describe the organization's current compensation system. What would you change?

Make sure you write in a clear, concise, and organized manner; demonstrate ethical scholarship in accurate representation and attribution of sources; display accurate spelling, grammar, and punctuation.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M93099615

Have any Question?


Related Questions in Homework Help/Study Tips

What is the relationship between race socio-economic status

What is the relationship between race, socio-economic status and cruel and unusual punishment? Consider the history of the United States and the 8th Amendment in your response

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

In chapters 5-8 of hillbilly elegy jd vance describes the

In chapters 5-8 of Hillbilly Elegy, JD Vance describes the chaos of his family life, and the various relationships he has with his family members. He describes the revolving door of men in his life, and the impact this h ...

Question 1 the criminal justice system in america has a

Question 1. The Criminal Justice System in America has a rich history. Please identify the different institutions of the American Criminal Justice System and its subcomponents (all the actors that are included in this su ...

Question 1 after having read the case study analysis on

Question: 1. After having read the case study analysis on Team Dynamics at Initech, fill out the Organizational Diagnosis Questionnaire (ODQ) developed by Preziosi. You are not required to answer all questions. For some ...

What is the best way to developing an integrative approach

What is the best way to developing an integrative approach to counseling: a. Is quite simplistic, as you would just combine the various techniques together from different theoretical approaches depending on the client's ...

Reflective journal my views on mass media or effects of

Reflective Journal : My Views on Mass Media or Effects of Advertising Write a 3/4 to 1 page journal entry (300 to 500 words) in which you: Describe one or two (1-2) experiences with mass media (movies or television) that ...

Question mass media worksheetcomplete this worksheet by

Question: Mass Media Worksheet Complete this worksheet by answering the following questions. In Part A, each response must be written as an academic paragraph of at least 150 words. Be clear and concise, and explain your ...

Answer the following questions what are your thoughts on

Answer the following Questions : What are your thoughts on the various "fad diets" including: diet foods, high protein diets, and very low calorie diets. Do you feel these are more or less effective than to exercise and ...

Assignment 12 conflicting viewpoints essay - part

Assignment 1.2: Conflicting Viewpoints Essay - Part II Synthesizing and Writing When looking for information about a particular issue, how often do you try to resist biases toward your own point of view? This assignment ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As