Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment 1: NIPP

Write a two to four (3-4) page paper in which you:

  1. Analyze the National Infrastructure Protection Plan and Risk Management Framework, located at, and conclude how it has been designed to protect the nation's critical infrastructure.
  2. Determine the purpose of the feedback loop design and argue how it strengthens or weakens the model. Justify your response.  
  3. Decide if taking a "risk management" approach is suitable for protecting the nation's critical infrastructure. Support your response.
  4. Choose the one (1) step that is the most important or has the greatest impact on the other steps of the Risk Management Framework and describe why.
  5. Discuss two (2) criticisms of the NIPP model and suggest ways of dealing with those criticisms.
  6. Use at least three (3) quality resources in this assignment.

Your assignment must follow these formatting requirements:

  • Be typed, double spaced, using Times New Roman font (size 12), with one-inch margins on all sides; citations and references must follow APA or school-specific format. Check with your professor for any additional instructions.
  • Include a cover page containing the title of the assignment, the student's name, the professor's name, the course title, and the date. The cover page and the reference page are not included in the required assignment page length.

The specific course learning outcomes associated with this assignment are:

  • Explain the national infrastructure plan in the context of strategic targets.
  • Use technology and information resources to research issues in homeland security.
  • Write clearly and concisely about topics related to Homeland Security Organization and Administration using proper writing mechanics and technical style conventions.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91365732
  • Price:- $30

Guranteed 24 Hours Delivery, In Price:- $30

Have any Question?


Related Questions in Homework Help/Study Tips

Question a credible person will do what they say describe a

Question: A credible person will do what they say. Describe a time when you felt free in displaying your integrity at work. Describe a time when you felt fearful displaying your integrity at work. What was the determinin ...

Internalized core conceptsthe core concepts that have been

Internalized Core Concepts The core concepts that have been internalized are the need for coaching, leadership development, clarification of purpose, and the importance of hiring the right coach. Executive coaching is th ...

1 write a one page report on any government

1. Write a one page report on any government current topic analyzing the pros and cons by utilizing current issues from any magazines, newspaper, or internet source - of your choice - source may come from either print or ...

Answer the following question 1 give an example of an

Answer the following Question : 1. Give an example of an innovative compensation or benefits program from within or outside the health care industry. Brief description 2. Evaluate the program selected a. In your opinion, ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question watch the first 30 minutes of the breaking the

Question: Watch the first 30 minutes of the "Breaking the Cycle" video available on the student website. Select and complete the following assignment: Option 1: Self-Regulation Presentation Using material in textbook rea ...

Question 250 words1 one of the greatest threats to human

Question: 250 words 1) One of the greatest threats to human and non-human species is climate change and environmental degradation from pollution. Choose any of the ethical frameworks studied so far and use it to argue fo ...

Assignment 1 lasa 2 analysis of a personalityfor this

Assignment 1: LASA 2: Analysis of a Personality For this assignment, you will have a chance to put into practice all you have been learning throughout this course. You will analyze the personality development of one of t ...

Question i need to select one of the following prompts

Question: I need to select one of the following prompts below to serve as the basis for a persuasive essay. There needs to be a firm stance on the prompt and there needs to be a written 5-paragraph, double-spaced essay s ...

Question mitch college student age 22 just tried his hand

Question: Mitch (college student, age 22) just tried his hand at stand-up comedy for the very first time at a bar near campus. Doing stand-up is something that has been very important to him since he was a kid. Unfortuna ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As