Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment 1 :

Learning Objectives

Students will:

• Develop diagnoses for clients receiving psychotherapy

• Evaluate the efficacy of cognitive behavioral therapy for clients

• Analyze legal and ethical implications of counseling clients with psychiatric disorders

Select a client whom you observed or counseled this week. Then, address the following in your Practicum Journal:

• Describe the client (without violating HIPAA regulations) and identify any pertinent history or medical information, including prescribed medications.

• Using the DSM-5, explain and justify your diagnosis for this client.

• Explain whether cognitive behavioral therapy would be effective with this client. Include expected outcomes based on this therapeutic approach. Support your approach with evidence-based literature.

• Explain any legal and/or ethical implications related to counseling this client

Assignment 2:

• Assess clients presenting for psychotherapy

• Develop genograms for clients presenting for psychotherapy. The genogram should extend back by at least three generations (great grandparents, grandparents, and parents).

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92466118
  • Price:- $20

Priced at Now at $20, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question values culture and underlying beliefs of human

Question: Values, culture, and underlying beliefs of human services providers may raise dilemmas when handling cases involving issues such as infidelity, domestic violence, and parenting matters. In this week's media pro ...

Length 1300-1600 words however the length of this paper

Length: 1300-1600 words (However, the length of this paper matters much less than the quality of your argument and your understanding of the course material.) For your final paper in this course, you will present your po ...

Question explain how the four primary financial statements

Question: Explain how the four primary financial statements are used to describe an organization's financial performance. What is the most important financial statement and why? The response must be typed, single spaced, ...

Question 1 what is the power of scenario planning2 explain

Question: 1. What is the power of scenario planning? 2. Explain the steps to construct a scenario planning? The response must be typed, single spaced, must be in times new roman font (size 12) and must follow the APA for ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question welcome to the unit viii discussion board be sure

Question: Welcome to the Unit VIII discussion board! Be sure to read the unit lesson and assigned readings before posting so that they can inform your post. Begin by reading the unit lesson first. Give an example of a pe ...

Question describe how the concepts of leadership and

Question: Describe how the concepts of leadership and management differ from each other. In what areas do they overlap? Explain how the goals of management and leadership may sometimes overlap. As a nurse leader, do you ...

Quesiton write a paper 2000-2500 words in which you apply

Quesiton: Write a paper (2,000-2,500 words) in which you apply the concepts of epidemiology and nursing research to a communicable disease. Refer to "Communicable Disease Chain," "Chain of Infection," and the CDC website ...

Promptthis paper is your first fieldwork assignment as an

Prompt This paper is your first fieldwork assignment as an ethnomusicologist-in-training: • Select and attend a live music performance in the Washington D.C./Maryland/Virginia area that involves at least two musicians. Y ...

Question please read this article it is an important part

Question: Please read this article it is an important part of the answer • Wilhelmy, A., Kleinmann, M., König, C. J., Melchers, K. G., & Truxillo, D. M. (2016). How and why do interviewers try to make impressions on appl ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As