Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment 1: Analyzing a Social Policy

In this course, you have learned that social policies are formulated to solve social problems considered important by a mass of voters, media, and political actors. Social policy is but one solution to the problem-not necessarily the most rational, effective, or socially just.

Social policies are human creations and, as such, can be changed. In this paper you will analyze a social policy as a tool for social justice.

Research one social welfare policy using your textbook, the Argosy University online library resources, and the Internet.

Analyze the policy and address the following:

The social problem addressed by the policy

What is/are the problem/s to be solved in the most fundamental terms?

What is the history of the problem/s in the United States?

What are the various theories about the causes of the problem/s? Based on this, what do you think is/are the most important causes/s of the problem/s?

The policy objectives, value premises, expectation, and target populations

Policy objectives-overt and covert objectives: What are the stated objectives of the policy? In your judgment, what are the covert objectives of the policy?

What are the values underlying the policy objectives? What values are revealed by the overt and covert objectives?

What did the policymakers expect would be the result of the policy?

Target segments of the population at whom policy is aimed: Discuss the direct target of the policy in terms of size and other demographic characteristics. Who are the indirect targets of the policy?

Effects of the policy

Intended effects: What effects did the lawmakers intend?

Unintended effects: What effects did the lawmakers not foresee?

Distinguish between short-range (less than five years) and long-range (over five years) effects of the policy.

Implications of the Policy

Changes in the distribution of material resources: Are there any changes to the distribution of material resources, including income and other tangible benefits, as a result of the policy for direct or indirect target groups?

Changes in distribution of services, rights, and statuses: Are there any changes in services, rights, or statuses as a result of the policy?

Alternative Policies

What alternative policy/policies would more effectively address the social problem discussed in the policy analysis while advancing social justice?

Write a 4-6-page paper in Word format. Apply APA standards to citation of sources.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91950906
  • Price:- $100

Priced at Now at $100, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Assignment interpersonal communication at your

Assignment : Interpersonal Communication at Your Workplace For this assignment, you have the opportunity to apply what you have learned from the assigned module readings and any additional research you may have done. You ...

Travel and tourism management assignment -learning outcomes

Travel and Tourism Management Assignment - Learning Outcomes - Understand the Rationale for planning in the Travel and Tourism Industry. Understand different approaches to tourism Planning and development. Understand the ...

Write a two page apa-formatted paper on the following

Write a two page, APA-formatted paper on the following topic: What actions can fire companies take to limit the spread of a structure fire; what actions can they do that would make the situation worse? I want you to thin ...

Question identifying and labeling cognitive distortions

Question: Identifying and labeling cognitive distortions can help you catch, modify and or change negative thinking when working with patients. How can you work with your patients concerning Cognition Distortion? The res ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Sociology - sociology of the familyshort answer

Sociology - Sociology of the Family Short Answer Questions Please answer questions in complete sentences on separate paper, typed, double-spaced. Be brief, using 1 - 2 sentences, and to-the-point. Sociological Theories o ...

Assignment as a healthcare professional you will be tasked

Assignment: As a healthcare professional, you will be tasked with making critical decisions that will test your ethical understanding and abilities. You are to take a short quiz that will provide you with actual cases: O ...

Question reflection paperin a reflection of 450-600 words

Question: Reflection Paper In a reflection of 450-600 words, explain how you see yourself fitting into the following IOM Future of Nursing recommendations: 1. Recommendation 4: Increase the proportion of nurses with a ba ...

Assignmenta cyber crime is a crime that involves a computer

Assignment A cyber crime is a crime that involves a computer and the Internet. A forensics investigation involves gathering and preserving evidence in a way that is suitable for presentation in a court of law. Use the li ...

What arguments support a connection between infant-parent

What arguments support a connection between infant-parent relationships and adult romantic relationships, according to attachment theory?

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As