Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment -

The question concerns data from a case-control study of esophageal cancer in Ile- et-Vilaine, France. The data is distributed with R and may be obtained along with a description of the variables by: BETA REGRESSION 65

data(esoph)

help(esoph)

(a) Plot the proportion of cases against each predictor using the size of the point to indicate the number of subject as seen in Figure 2.7. Comment on the relationships seen in the plots.

(b) Fit a binomial GLM with interactions between all three predictors. Use AIC as a criterion to select a model using the step function. Which model is selected?

(c) All three factors are ordered and so special contrasts have been used appropriate for ordered factors involving linear, quadratic and cubic terms. Further simplification of the model may be possible by eliminating some of these terms. Use the unclass function to convert the factors to a numerical representation ?and check whether the model may be simplified.

(d) Use the summary output of the factor model to suggest a model that is slightly ?more complex than the linear model proposed in the previous question.

(e) Does your final model fit the data? Is the test you make accurate for this data?

(f) Check for outliers in your final model.

(g) What is the predicted effect of moving one category higher in alcohol consumption?

(h) Compute a 95% confidence interval for this predicted effect.

The dataset "discoveries" lists the numbers of "great" inventions and scientific discoveries in each year from 1860 to 1959.

(a) Plot the discoveries over time and comment on the trend, if any.

(b) Fit a Poisson response model with a constant term. Now compute the mean number of discoveries per year. What is the relationship between this mean ?and the coefficient seen in the model?

(c) Use the deviance from the model to check whether the model fits the data. ?What does this say about whether the rate of discoveries is constant over time?

(d) Make a table of how many years had zero, one, two, three, etc. discoveries. Collapse eight or more into a single category. Under an appropriate Poisson ?distribution, calculate the expected number of years with each number of discoveries. Plot the observed against the expected using a different plotting character to denote the number of discoveries. How well do they agree?

(e) Use the Pearson's Chi-squared test to check whether the observed numbers are consistent with the expected numbers. Interpret the result.

(f) Fit a Poisson response model that is quadratic in the year. Test for the significance of the quadratic term. What does this say about the presence of a trend in discovery?

(g) Compute the predicted number of discoveries each year and show these pre- dictions as a line drawn over the data. Comment on what you see.

The debt data arise from a large postal survey on the psychology of debt. The frequency of credit card use is a three-level factor ranging from never, through occasionally to regularly.

(a) Declare the response as an ordered factor and make a plot showing the rela- tionship to prodebt. Comment on the plot. Use a table or plot to display the relationship between the response and the income group.

(b) Fit a proportional odds model for credit card use with all the other variables as predictors. What are the two most significant predictors (largest t-values) and what is their qualitative effect on the response? What is the least significant predictor?

(c) Fitaproportionaloddsmodelusingonlytheleastsignificantpredictorfromthe previous model. What is the significance of this predictor in this small model? Are the conclusions regarding this predictor contradictory for the two models?

(d) Use stepwise AIC to select a smaller model than the full set of predictors. You will need to handle the missing values carefully. Report on the qualitative effect of the predictors in your chosen model. Can we conclude that the predictors that were dropped from the model have no relation to the response?

(e) Compute the median values of the predictors in your selected model. At these median values, contrast the predicted outcome probabilities for both smokers and nonsmokers.

(f) Fit a proportional hazards model to the same set of predictors and re-compute the two sets of probabilities from the previous question. Does it make a difference to use this type of model?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92772960

Have any Question?


Related Questions in Homework Help/Study Tips

Task - sketch cost plan using the provided drawings prepare

Task - Sketch Cost Plan: Using the provided drawings prepare an elemental sketch design cost plan (comparative cost estimate) for Blue Point Road Project. The format must be similar to the ACMM format. The price should b ...

Textbook grazian d 2017 mix it up popular culture mass

Textbook: Grazian, D. (2017). Mix it Up: Popular Culture, Mass Media, and Society, 2nd edition. New York: W.W. Norton. 300 words. Only this text can be used for citations. No outside sources. On page 109, Grazian states, ...

Discussionmiddot what type of murder did anakin commit in

Discussion · What type of murder did Anakin commit in "killing" his wife? · In some cases, one can build an argument that Anakin is a terrorist. How can you justify this statement using the types/forms of terrorists desc ...

Assignment 3 essay anxiety and attentionpart i compare and

Assignment 3: Essay: Anxiety and Attention Part I: Compare and contrast how the anxiety-performance relationship is explained by the individual zones of optimal functioning model, multidimensional anxiety theory, and cus ...

Workplace barriers facing black caribbean women in the

Workplace Barriers facing Black Caribbean Women in the United States ASSIGNMENT 1 1. Historical Background a. Put things in perspective. This is more than just a chronology and does not necessarily have to include every ...

Type out your answers to each essay question provided in a

Type out your answers to each essay question provided in a Microsoft Word document Please clearly label each answer with the respective question number. Answering all parts of the question, grammar, organization, and cla ...

Question banks industries is currently operating in both

Question: BANKS Industries is currently operating in both the United States and China. As a US-based company, BANKS is accustomed to conforming to US law regarding employee health and safety. However, Chinese law is diff ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question reading sales territory case wikipediaassignment 1

Question: Reading: Sales territory case (wikipedia) Assignment: 1) Read through this brief article on sales territories, 2) Identify a product or service with which you are familiar 3) Define a sales territory where you ...

Case brief 71 in re yukos oil company securities

CASE BRIEF 7.1 : In re Yukos Oil Company Securities Litigation 2006 WL 3026024 (S.D.N.Y.) Questions: 1. Describe how Yukos is alleged to have saved significant amounts in taxes. 2. Explain what act of the Russian Federat ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As