Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment : Genogram,Ecomap, Family Hlth Promo Plan

Instructions

This assignment assesses intended course outcomes(s):

1. Apply the nursing process and evidence-based practice to accurately assess family and community health systems across the lifespan

2. Apply systematic research practices to identify family and community health system needs.

3. Develop appropriate risk reduction and health promotion education plans based on identified family and community risk factors.

4. Develop appropriate risk reduction and health promotion education plans based on identified family and community risk factors.

Discuss the multi-dimensional role of the community health nurse in risk reduction and health promotion.

In this assignment, the student will conduct an assessment of a family and apply the nursing process to form a plan of care. The family needs to have at least three members in the household and at least one family member must have a health care need. The family can be of any type of structure (traditional or non-traditional). The student will conduct a genogram which demonstrates patterns of disorders that are prevalent in the family. On the same family the student will then construct an ecomap.

An ecomap is a representation of how the family connects to the outside world. Based on this information, the student needs to select a family or community theory (refer to information in LEO classroom) and construct a plan of care based on this theory utilizing the nursing process.
Family genogram

? You can use your own family for this assignment. Remember, the family genogram must represent a family in the same community you wrote about in your windshield survey.

? Using the information, examples, and templates provided, construct a family genogram of your family. Please omit any identifying information (e.g., names).

? This link provides additional information and instructions for construction of a family genogram. This link provides examples of completed genograms.

? You can use the attached template [link to genogram file] or create your own.

? Submit the completed genogram as a separate document prior to working on the ecomap.

Ecomap

? Using the family genogram data, construct an ecomap of the family depicting how the family interacts with community resources/entities/agencies to meet the family's needs. Make note of any family need that cannot be met in the community, as this information will be needed in your next assignment.

? Instructions on completing an ecomap are provided in this link.

? An interactive example of ecomap construction is provided in this link

? The attached template link to ecomap file can help you create your own ecomap.

? Once you have completed your ecomap be sure to provide statistical data about your community, such as population, socioeconomic data, and disease prevalence/incidence data. You can find data through Healthy People 2020, the CDC, the US Census Bureau, and the National Vital Statistics System. The statistical data along with the observational data from your windshield survey and the outline of the community assessment process presented in Week 4 will constitute a mini-community assessment. Your next two assignments (in Weeks 6 and 8) will be constructed from these materials.

Family teaching plan

Using the nursing process and the data obtained from the genogram and ecomap, develop a teaching plan based on the needs of the family.

Select a family or community theory

Create a plan based on this theory (details)

Summarized the identified health risk traits

Evidence-based health care promotion and disease prevention recommendations based on the family's identified health risk.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92188019
  • Price:- $40

Priced at Now at $40, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question topic sexual harassment amongst the employees and

Question: Topic: Sexual Harassment amongst the employees and the strategies of its eliminating Write a 6 page paper using the following outline: 1) Description of the problem 2) Summary of actions taken to address the pr ...

Question operations are an important management function in

Question: Operations are an important management function in an organization. The role of operations management changes as companies react to the business environment. Using the Argosy University online library resources ...

Question what are some red flags that would indicate client

Question: What are some red flags that would indicate client resistance? How can you most effectively deal with resistance? Will a client with substance use disorder be more resistant than a client with a general mental ...

Question the basic guidelines for analyzing ethical case

Question: The basic guidelines for analyzing ethical case are as follows: 1. Issues a. What are the major moral or ethical issues raised by the case? b. What are the major factual issues raised by the case? c. What are t ...

Assessment - reflective essaylearning outcomesa describe

Assessment - Reflective Essay Learning Outcomes a) Describe and evaluate the objectives, aims and the primary aspects of a strategic plan whilst taking into account the vision and mission of the organisation. b) Discuss ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question write a 1050- to 1400-word paper about enterprise

Question: Write a 1,050- to 1,400-word paper about enterprise risk management (ERM). Include the following in your paper: • Explain the difference between traditional and enterprise risk management. • Explain why enterpr ...

Question one of the main objectives of this course is for

Question: One of the main objectives of this course is for you to examine your ethnic heritage, cultural identity, values, and assumptions and analyze their impact on the provision of culturally competent services; there ...

Assessment written reportfocus of report analysis of

Assessment: Written Report Focus of report: Analysis of HRM-related issues and their solutions You are required to investigate current HRM-related issues in the workplace. You are to conduct research into a workplace of ...

Discussion five that mattered oprah winfrey says each of us

Discussion: Five That Mattered Oprah Winfrey says, "Each of us arrives with all we need to feel valued and unique, but slowly that gets chipped away." She is correct, but some life experiences do cause us to increase the ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As